CFTR-NGS catalogue

*CFTR*-NGS Variant details:
Name	NM_000492.4:c.1392+1520dupA
Protein name	NP_000483.3:p.(?)
Genomic name (hg19)	chr7:g.117190397dup UCSC
#Exon/intron	intron 10
Type in CFTR-NGS catalogue	repeat
*Class in CFTR-France*	not reported
WT sequence	GTGATAGGCTCAAAAAAAAAAAAAA - TTGGTGTTTGCAATGCTAATAATAC
Mutant sequence	GTGATAGGCTCAAAAAAAAAAAAAA A TTGGTGTTTGCAATGCTAATAATAC

Additional information:
MAF (GnomAD)	3.54e-02
Splicing prediction (SpliceAI)	AG: 0.00 (-15) AL: 0.00 (-3) DG: 0.00 (-25) DL: 0.00 (-11)

External sources:
Not found	Not found	dbSNP no rs	Not found

Variant validation:
Sanger (present/not present/not verified)	Minigene (effect/no effect/not performed)
not verified	not performed

No patient found in CFTR-France

Details of NGS patients:
ID	Phenotype	Laboratory	Experiment	Variant status	Variant filter	Quality score	Depth of coverage
MUCO07299	Asymptomatic	Montpellier	100714_varilh	heterozygous	PASS	453	269
MUCO07585	Asymptomatic	Montpellier	100714_varilh	heterozygous	PASS	425	218
MUCO07621	Asymptomatic	Montpellier	100714_varilh	heterozygous	PASS	1756	116
MUCO07658	Asymptomatic	Montpellier	100714_varilh	heterozygous	PASS	430	200
9004	Asymptomatic	Montpellier	40216_varilh	heterozygous	PASS	526	326
22	CF	Montpellier	150517_varilh	heterozygous	PASS	851	407
9879	CF	Montpellier	160218_varilh	heterozygous	PASS	423	259
9883	CF	Montpellier	160218_varilh	heterozygous	PASS	594	291
9886	CF	Montpellier	160218_varilh	heterozygous	LowQD	329	224
21	CF	Montpellier	150517_varilh	heterozygous	PASS	619	362
9	CFTR-RD	Montpellier	150517_varilh	heterozygous	LowQD	523	420
5	CFTR-RD	Montpellier	150517_varilh	heterozygous	PASS	645	389
6959	CFTR-RD	Montpellier	40216_varilh	heterozygous	PASS	397	154
17MU00956	CFTR-RD	Cochin	150419_Altieri	heterozygous	PASS	546	192
5543	Pending (NBS)	Montpellier	40216_varilh	heterozygous	PASS	375	156
5847	Pending (NBS)	Montpellier	40216_varilh	heterozygous	PASS	707	263
13	Pending (NBS)	Montpellier	150517_varilh	heterozygous	PASS	533	347
3	Pending (NBS)	Montpellier	150517_varilh	heterozygous	LowQD	448	365
11	Pending (NBS)	Montpellier	150517_varilh	heterozygous	PASS	1078	370
7015	Suspicion of CF	Montpellier	40216_varilh	heterozygous	PASS	844	370
8293	Suspicion of CF	Montpellier	40216_varilh	heterozygous	PASS	564	243
50070	Suspicion of CF	Montpellier	40216_varilh	heterozygous	PASS	547	300
m8852	Suspicion of CF	Montpellier	150419_Altieri	heterozygous	PASS	658	117

Go to