Variant NM_000492.4:c.870-1113_870-1110del


Variant details:
Name NM_000492.4:c.870-1113_870-1110del
Protein name NP_000483.3:p.(=)
Genomic name (hg19) chr7:g.117179041_117179044del    UCSC    
#Exon/intron intron 7
Class disease-causing
Subclass varying clinical consequence
WT sequence CTCTTAGTTCTGCACTTGAGAATGA GAAT AGCTTTTCTGAATTATACAAGGAAG
Mutant sequence CTCTTAGTTCTGCACTTGAGAATGA ---- AGCTTTTCTGAATTATACAAGGAAG

Other databases:

Not found
Not found		dbSNP
no rs







Pathogenicity predictors:

Not found





No patient found in CFTR-NGS catalogue


35 patients carrying this variant are reported in CFTR-France:

TOTAL NUMBER OF PATIENTS 35
CF 23
CFTR-RD11
  • Bronchiectasis  1
  • CBAVD  4
  • CRS-NP  2
  • Other  2
  • Pancreatitis  2
Pending (NBS) 1




Color code:   non disease-causing <   likely benign <   VUS <   likely pathogenic <   disease-causing

Detailed genotypes:
Phenotype Patient ID Variant status Additional variants
CF 4718heterozygoteCF-causing - Trans
CF 2489heterozygoteCF-causing- Undef
CF 5898heterozygoteCF-causing - Trans
CF 5016heterozygoteCF-causing- Undef
CF 3137heterozygoteCF-causing - Trans
CF 5174heterozygoteCF-causing - Trans
CF 5345heterozygoteCF-causing - Trans
CF 5899heterozygoteCF-causing - Trans
CF 1232heterozygoteCF-causing- Undef
CF 207heterozygoteCF-causing - Trans
CF 316heterozygoteCF-causing- Undef
CF 471heterozygoteCF-causing- Undef
CF 662heterozygoteVUS2 - Trans
CF-causing - Trans
CF 663heterozygoteVUS2 - Trans
CF-causing - Trans
CF 788heterozygoteCF-causing- Undef
CF 798heterozygoteCF-causing - Trans
CF 808heterozygoteCF-causing - Trans
CF 909heterozygoteCF-causing - Trans
CF 947heterozygoteCF-causing- Undef
CF 5263heterozygoteCF-causing - Trans
CF 4796heterozygoteCF-causing - Cis
CF-causing - Trans
VUS3- Undef
VUS3- Undef
CF 4941homozygotec.870-1113_870-1110del - p.(=) - Trans
CF 4892homozygotec.1521_1523del - p.(Phe508del) - Trans
c.870-1113_870-1110del - p.(=) - Trans
Pancreatitis 5329heterozygote
Pancreatitis 4721heterozygoteCF-causing- Undef
CBAVD 3125heterozygoteCF-causing - Trans
VUS1- Undef
CBAVD 3271heterozygoteCFTR-RD-causing- Undef
CBAVD 1287heterozygoteCFTR-RD-causing- Undef
CBAVD 527heterozygote
CRS-NP 4649heterozygoteCF-causing - Trans
CRS-NP 3161heterozygoteCF-causing - Trans
VUS1- Undef
Other 5967heterozygoteCF-causing - Cis
Other 5360heterozygoteCF-causing - Trans
Bronchiectasis 5972heterozygoteVUS3- Undef
Pending (NBS) 5951heterozygoteCF-causing - Trans


Color code:   non disease-causing <   likely benign <   VUS <   likely pathogenic <   disease-causing



            CFTR variants are clustered into five groups:
  • CF-causing: when in trans with another CF-causing mutation, will result in CF.
  • CFTR-RD causing: when in trans with a CF-causing mutation, will result in CFTR-related disorders (CFTR-RD) such as chronic pancreatitis, bronchiectasis, CRS-NP (chronic rhinosinusitis with or without nasal polyposis) or CBAVD (congenital absence of vas deferens), according to Bombieri C et al., 2011.
  • Varying clinical consequence: when in trans with another CF-causing mutation, can either result in CF or in a CFTR-RD.
  • Non disease-causing: when in trans with a CF-causing mutation, will not cause CF, nor CFTR-RD.
  • VUS (Variant of unknown clinical significance): unclassified because of insufficient data.



Go to CFTRare