Updates for c.1521_1523del:
2023-02-02 name changed from c.1521_1523delCTT to c.1521_1523del




Variant NM_000492.4:c.1521_1523del


Variant details:
Name NM_000492.4:c.1521_1523del
Protein name NP_000483.3:p.(Phe508del)
Genomic name (hg19)     chr7:g.117199646_117199648del    UCSC    
Genomic name (hg38) chr7:g.117559592_117559594del    UCSC
#Exon/intron exon 11
Legacy Name ΔF508
Class disease-causing
Subclass CF-causing
complex allele in 0.58% of patients associated with
  • c.3080T>C - p.(Ile1027Thr) : 73.91%
  • c.1399C>T - p.(Leu467Phe) : 26.09%
  • WT sequence CTGGCACCATTAAAGAAAATATCAT CTT TGGTGTTTCCTATGATGAATATAGA
    Mutant sequence CTGGCACCATTAAAGAAAATATCAT --- TGGTGTTTCCTATGATGAATATAGA

    Other databases:
    dbSNP
    rs113993960







    Pathogenicity predictors:

    Not found


    Reference PMID Splicing mRNA level Maturation Localization Channel fonction (Cl-) Bicarbonate
    Gregory et al, 1991 1712898
    Van Goor et al, 2014 23891399


    « ✓ » indicates the type of analysis performed and not the results



    Modulator FDA approval EMA approval in vitro / ex vivo data clinical data
    IVAnononono
    TEZ-IVA yesnoyesno
    ELX-TEZ-IVA yes yesno yes
    VNZ-TEZ-DIVA yesnoyesno

    clinical and functional data presented above are provided by Vertex


    49 individuals carrying this variant are reported in CFTR-NGS catalogue


    3972 patients carrying this variant are reported in CFTR-France:

    TOTAL NUMBER OF PATIENTS 3972
    Asymptomatic compound heterozygote 73
    CF 2702
    CFTR-RD917
    • Aquagenic palmoplantar keratoderma  7
    • Bronchiectasis  95
    • CBAVD  583
    • CRS-NP  20
    • Other  140
    • Pancreatitis  72
    Fetal bowel anomalies 58
    Pending 30
    Pending (NBS) 184
    Pending non-CF 8




    Color code:   non disease-causing <   likely benign <   VUS <   likely pathogenic <   disease-causing

    Detailed genotypes:
    Phenotype Patient ID Variant status Additional variants
    CF 1heterozygoteCF-causing - Trans
    CF 2heterozygoteCF-causing - Trans
    CF 3heterozygoteCF-causing - Trans
    CF 6heterozygoteCF-causing - Trans
    CF 7heterozygoteCF-causing - Trans
    CF 11heterozygoteCF-causing - Trans
    CF 14heterozygoteCF-causing - Trans
    CF 16heterozygoteCF-causing- Undef
    CF 25heterozygotevarying clinical consequence - Trans
    CF 32heterozygoteCF-causing - Trans
    CF 33heterozygoteCF-causing - Trans
    CF 36heterozygoteCF-causing - Trans
    CF 37heterozygoteCF-causing - Trans
    CF 39heterozygoteCF-causing - Trans
    CF 41heterozygotevarying clinical consequence - Trans
    CF 43heterozygoteCF-causing - Trans
    CF 45heterozygoteCF-causing - Trans
    CF 46heterozygoteCF-causing - Trans
    CF 51heterozygoteCF-causing - Trans
    CF 59heterozygotevarying clinical consequence- Undef
    CF 61heterozygoteCF-causing - Trans
    CF 62heterozygoteCF-causing - Trans
    CF 63heterozygoteCF-causing - Trans
    CF 69heterozygoteCF-causing - Trans
    CF 73heterozygotevarying clinical consequence - Trans
    CF 79heterozygoteCF-causing - Trans
    CF 82heterozygoteCF-causing - Trans
    CF 83heterozygoteCF-causing - Trans
    CF 4689heterozygoteCF-causing - Trans
    CF 4700heterozygoteCF-causing - Trans
    CF 4719heterozygotevarying clinical consequence - Trans
    CF 4732heterozygotevarying clinical consequence - Trans
    CF 86heterozygoteCF-causing - Trans
    CF 4845heterozygoteCF-causing - Trans
    CF 88heterozygoteCFTR-RD-causing - Trans
    CF-causing - Trans
    CF 89heterozygoteCF-causing - Trans
    CF 90heterozygotevarying clinical consequence - Trans
    CF 91heterozygoteCF-causing - Trans
    CF 92heterozygoteCF-causing - Trans
    CF 94heterozygoteCF-causing - Trans
    CF 96heterozygoteVUS2 - Cis
    CF-causing - Trans
    CF 99heterozygoteCF-causing - Trans
    CF 100heterozygoteCF-causing - Trans
    CF 105heterozygoteCF-causing - Trans
    CF 107heterozygoteCF-causing - Trans
    CF 109heterozygoteCF-causing- Undef
    CF 113heterozygoteCF-causing - Trans
    CF 117heterozygoteCF-causing - Trans
    CF 120heterozygoteCF-causing - Trans
    CF 121heterozygoteCF-causing - Trans
    CF 122heterozygoteCF-causing - Trans
    CF 123heterozygoteCF-causing - Trans
    CF 131heterozygoteVUS3 - Trans
    CF-causing - Trans
    CF 132heterozygoteVUS3 - Cis
    CF-causing - Trans
    CF 133heterozygoteCF-causing - Trans
    CF 137heterozygoteCF-causing - Trans
    CF 138heterozygoteCF-causing - Trans
    CF 141heterozygoteCF-causing - Trans
    CF 145heterozygoteCF-causing - Trans
    CF 148heterozygoteCF-causing - Trans
    CF 151heterozygoteCF-causing - Trans
    CF 152heterozygoteCF-causing - Trans
    CF 154heterozygoteCF-causing - Trans
    CF 157heterozygoteCF-causing - Trans
    CF 158heterozygoteCF-causing- Undef
    CF 159heterozygotevarying clinical consequence - Trans
    CF 160heterozygoteCF-causing - Trans
    CF 161heterozygoteCF-causing - Trans
    CF 162heterozygoteCF-causing - Trans
    CF 163heterozygoteCF-causing - Trans
    CF 164heterozygoteCF-causing - Trans
    CF 165heterozygoteCF-causing - Trans
    CF 166heterozygoteCF-causing- Undef
    CF 167heterozygoteCF-causing- Undef
    CF 170heterozygoteCF-causing- Undef
    CF 171heterozygotevarying clinical consequence- Undef
    CF 173heterozygoteCF-causing- Undef
    CF 174heterozygoteCF-causing- Undef
    CF 175heterozygoteCF-causing- Undef
    CF 178heterozygoteVUS3 - Cis
    non-CF - Cis
    CF-causing - Trans
    CF 181heterozygoteCF-causing - Trans
    CF 182heterozygoteCF-causing - Trans
    CF 183heterozygoteCF-causing - Trans
    CF 184heterozygoteCF-causing - Trans
    CF 185heterozygoteCF-causing - Trans
    CF 187heterozygoteVUS3- Undef
    CF-causing- Undef
    CF 190heterozygoteCF-causing- Undef
    CF 195heterozygoteCF-causing - Trans
    VUS3- Undef
    CF 197heterozygotevarying clinical consequence- Undef
    CF 198heterozygoteCF-causing- Undef
    CF 200heterozygoteCF-causing - Trans
    CF 201heterozygoteCF-causing- Undef
    CF 202heterozygoteVUS3- Undef
    CF-causing- Undef
    CF 203heterozygoteCF-causing - Trans
    CF 206heterozygote
    CF 208heterozygoteCF-causing - Trans
    CF 209heterozygoteCF-causing- Undef
    CF 214heterozygotevarying clinical consequence- Undef
    CF 215heterozygoteVUS3 - Trans
    CF 216heterozygoteCF-causing - Trans
    CF 217heterozygoteCF-causing - Trans
    CF 218heterozygoteCF-causing- Undef
    CF 219heterozygotevarying clinical consequence- Undef
    CF 220heterozygotevarying clinical consequence- Undef
    CF 221heterozygoteCF-causing- Undef
    CF 222heterozygoteCF-causing- Undef
    CF 223heterozygoteCF-causing - Trans
    CF 224heterozygoteCF-causing - Trans
    CF 225heterozygotelikely CF - Trans
    CF 227heterozygotevarying clinical consequence - Trans
    CF 228heterozygotevarying clinical consequence - Trans
    CF 229heterozygoteCF-causing- Undef
    CF 231heterozygoteCF-causing - Trans
    CF 232heterozygotevarying clinical consequence - Trans
    CF 233heterozygotevarying clinical consequence - Trans
    CF 234heterozygoteCF-causing- Undef
    CF 5079heterozygoteCF-causing - Trans
    CF 237heterozygoteCF-causing - Trans
    CF 238heterozygotevarying clinical consequence - Trans
    CF 239heterozygoteCF-causing - Trans
    CF 240heterozygoteCF-causing- Undef
    CF 245heterozygoteVUS3 - Cis
    VUS3 - Cis
    CF-causing - Trans
    CF 248heterozygoteCF-causing - Trans
    CF 249heterozygotevarying clinical consequence - Trans
    CF 252heterozygoteCF-causing- Undef
    CF 254heterozygoteCF-causing- Undef
    CF 255heterozygoteCF-causing - Trans
    CF 257heterozygotevarying clinical consequence - Trans
    CF 262heterozygotevarying clinical consequence - Trans
    CF 264heterozygotevarying clinical consequence- Undef
    CF 265heterozygoteCF-causing- Undef
    CF 266heterozygoteCF-causing - Trans
    CF 270heterozygoteCF-causing - Trans
    CF 271heterozygoteCF-causing - Trans
    CF 272heterozygoteCF-causing- Undef
    CF 274heterozygoteCF-causing - Trans
    CF 276heterozygoteCF-causing - Trans
    CF 277heterozygotevarying clinical consequence- Undef
    CF 280heterozygotevarying clinical consequence - Trans
    CF 281heterozygoteCF-causing - Trans
    CF 283heterozygoteCF-causing- Undef
    CF 285heterozygoteCF-causing- Undef
    CF 287heterozygoteCF-causing- Undef
    CF 288heterozygoteCF-causing- Undef
    CF 290heterozygoteCF-causing- Undef
    CF 291heterozygoteCF-causing- Undef
    CF 292heterozygoteCF-causing - Trans
    CF 293heterozygoteCF-causing - Trans
    CF 304heterozygoteVUS3 - Cis
    CF-causing - Trans
    CF 306heterozygoteCF-causing - Trans
    CF 307heterozygoteCF-causing - Trans
    CF 308heterozygoteCF-causing - Trans
    CF 309heterozygoteCF-causing - Trans
    CF 310heterozygoteCF-causing - Trans
    CF 313heterozygoteCFTR-RD-causing - Trans
    varying clinical consequence- Undef
    CF 317heterozygoteCF-causing - Trans
    CF 318heterozygoteCF-causing- Undef
    CF 319heterozygoteCF-causing - Trans
    CF 320heterozygoteCF-causing- Undef
    CF 321heterozygotevarying clinical consequence- Undef
    CF 326heterozygotevarying clinical consequence- Undef
    CF 328heterozygoteCF-causing- Undef
    CF 331heterozygoteCF-causing - Trans
    CF 332heterozygoteCF-causing - Trans
    CF 333heterozygotevarying clinical consequence - Trans
    CF 334heterozygoteCF-causing - Trans
    CF 336heterozygoteCF-causing - Trans
    CF 338heterozygotelikely CF - Trans
    CF 340heterozygoteVUS3 - Trans
    CF-causing - Trans
    CF 346heterozygoteCF-causing - Trans
    CF 347heterozygotevarying clinical consequence - Trans
    CF 350heterozygoteCF-causing- Undef
    CF 353heterozygoteCF-causing - Trans
    CF 355heterozygoteCF-causing - Trans
    CF 356heterozygoteCF-causing - Trans
    CF 357heterozygoteCF-causing - Trans
    CF 359heterozygoteVUS3 - Cis
    CF-causing - Trans
    CF 361heterozygoteCF-causing - Trans
    CF 363heterozygoteCF-causing - Trans
    CF 369heterozygotevarying clinical consequence- Undef
    CF 373heterozygoteCF-causing - Trans
    CF 374heterozygoteCFTR-RD-causing - Trans
    CF 380heterozygoteCF-causing- Undef
    CF 382heterozygoteVUS3 - Trans
    VUS3 - Trans
    CF 384heterozygoteCF-causing - Trans
    CF 386heterozygoteCF-causing - Trans
    CF 390heterozygoteCF-causing - Trans
    CF 466heterozygoteCF-causing - Trans
    VUS3- Undef
    CF 502heterozygoteCF-causing- Undef
    CF 509heterozygoteCF-causing - Trans
    CF 559heterozygotevarying clinical consequence - Trans
    CF 564heterozygoteCF-causing - Trans
    CF 567heterozygoteCF-causing - Trans
    CF 576heterozygoteCF-causing - Trans
    CF 588heterozygoteCF-causing - Trans
    CF 600heterozygotevarying clinical consequence- Undef
    CF 601heterozygoteCF-causing- Undef
    CF 602heterozygoteCF-causing - Trans
    CF 604heterozygoteCF-causing - Trans
    CF 611heterozygoteCF-causing - Trans
    CF 616heterozygoteCF-causing - Trans
    CF 620heterozygoteCF-causing - Trans
    CF 622heterozygotevarying clinical consequence - Trans
    CF 623heterozygotevarying clinical consequence - Trans
    CF 641heterozygoteCF-causing - Trans
    CF 649heterozygoteCF-causing - Trans
    CF 651heterozygoteCF-causing - Trans
    CF 654heterozygoteCF-causing- Undef
    CF 657heterozygoteCF-causing - Trans
    CF 661heterozygoteCF-causing - Trans
    CF 662heterozygoteVUS2 - Cis
    varying clinical consequence - Trans
    CF 663heterozygoteVUS2 - Cis
    varying clinical consequence - Trans
    CF 666heterozygoteCF-causing - Trans
    VUS3 - Trans
    CF 668heterozygoteCF-causing - Trans
    CF 671heterozygoteCF-causing- Undef
    CF 672heterozygoteCF-causing - Trans
    CF 681heterozygoteCF-causing - Trans
    CF 683heterozygoteCF-causing - Trans
    CF 684heterozygoteCF-causing- Undef
    CF 688heterozygoteCF-causing - Trans
    CF 691heterozygoteCF-causing - Trans
    CF 695heterozygoteCF-causing - Trans
    CF 696heterozygoteCFTR-RD-causing - Trans
    CF-causing - Trans
    CF 702heterozygoteCF-causing - Trans
    CF 703heterozygoteCF-causing - Trans
    CF 704heterozygoteCF-causing - Trans
    CF 706heterozygoteCF-causing - Trans
    CF 711heterozygoteCF-causing - Trans
    CF 714heterozygoteCF-causing - Trans
    CF 715heterozygoteCF-causing - Trans
    CF 716heterozygoteCF-causing- Undef
    CF 723heterozygoteCF-causing - Trans
    CF 731heterozygoteCF-causing - Trans
    CF 732heterozygoteCF-causing - Trans
    CF 733heterozygoteVUS3- Undef
    CF 738heterozygoteCF-causing - Trans
    CF 742heterozygotevarying clinical consequence- Undef
    CF 745heterozygoteCF-causing - Trans
    CF 747heterozygoteCF-causing - Trans
    CF 758heterozygoteCF-causing - Trans
    CF 761heterozygoteCF-causing - Trans
    CF 762heterozygoteCF-causing- Undef
    CF 773heterozygoteCF-causing - Trans
    CF 783heterozygotevarying clinical consequence - Trans
    CF 5084heterozygoteCF-causing - Trans
    CF 787heterozygotevarying clinical consequence - Trans
    CF 795heterozygoteCF-causing - Trans
    CF 800heterozygoteCF-causing - Trans
    CF 813heterozygotevarying clinical consequence - Trans
    CF 814heterozygoteCF-causing - Trans
    CF 820heterozygoteCF-causing - Trans
    CF 821heterozygotevarying clinical consequence - Trans
    CF 822heterozygotevarying clinical consequence - Trans
    CF 835heterozygoteCF-causing - Trans
    CF 836heterozygoteCF-causing - Trans
    CF 842heterozygoteCF-causing- Undef
    CF 843heterozygoteCF-causing - Trans
    CF 844heterozygoteCF-causing- Undef
    CF 846heterozygoteCF-causing - Trans
    CF 848heterozygoteCF-causing - Trans
    CF 860heterozygoteVUS3 - Cis
    CF-causing - Trans
    CF 863heterozygoteCF-causing - Trans
    CF 867heterozygoteCF-causing - Trans
    CF 872heterozygoteCF-causing - Trans
    CF 878heterozygoteCF-causing - Trans
    CF 882heterozygoteCF-causing- Undef
    CF 884heterozygoteCF-causing - Trans
    CF 889heterozygoteCF-causing - Trans
    CF 906heterozygoteCF-causing - Trans
    CF 913heterozygotevarying clinical consequence- Undef
    CF 920heterozygoteVUS2- Undef
    CF-causing- Undef
    CF 924heterozygoteCF-causing - Trans
    CF 926heterozygotevarying clinical consequence - Trans
    CF 928heterozygoteCF-causing - Trans
    CF 929heterozygoteCF-causing - Trans
    CF 943heterozygotevarying clinical consequence - Trans
    CF 945heterozygoteCF-causing- Undef
    CF 947heterozygotevarying clinical consequence- Undef
    CF 952heterozygotevarying clinical consequence - Trans
    CF 953heterozygoteCF-causing - Trans
    CF 954heterozygoteCF-causing - Trans
    CF 955heterozygoteCF-causing - Trans
    CF 956heterozygoteCF-causing - Trans
    CF 957heterozygoteCF-causing - Trans
    CF 960heterozygoteCF-causing - Trans
    CF 968heterozygoteCF-causing - Trans
    CF 969heterozygoteCF-causing - Trans
    CF 970heterozygoteCF-causing - Trans
    CF 973heterozygoteCF-causing- Undef
    CF 984heterozygoteCF-causing - Trans
    CF 985heterozygoteCF-causing - Trans
    CF 989heterozygoteCF-causing- Undef
    CF 994heterozygoteCF-causing - Trans
    CF 997heterozygotevarying clinical consequence - Trans
    CF 1000heterozygoteCF-causing - Trans
    CF 1002heterozygotevarying clinical consequence - Trans
    CF 1005heterozygoteCF-causing - Trans
    CF 1006heterozygoteCF-causing - Trans
    CF 1007heterozygoteCF-causing - Trans
    CF 1010heterozygoteCF-causing - Trans
    CF 4822heterozygoteCF-causing - Trans
    CF 4823heterozygoteCF-causing - Trans
    CF 1012heterozygoteCF-causing - Trans
    CF 4831heterozygoteCFTR-RD-causing- Undef
    varying clinical consequence- Undef
    CF 4832heterozygoteCF-causing- Undef
    CF 5143heterozygoteCF-causing- Undef
    CF 6431heterozygoteCF-causing - Trans
    CF 5227heterozygoteCF-causing - Trans
    CF 5089heterozygotevarying clinical consequence - Trans
    CF 5135heterozygoteCF-causing - Trans
    CF 5178heterozygoteCF-causing- Undef
    CF 5244heterozygoteVUS3 - Trans
    CF 5256heterozygoteCF-causing- Undef
    VUS2- Undef
    CF 5534heterozygoteCF-causing - Trans
    CF 6351heterozygoteCF-causing - Trans
    CF 6352heterozygoteCF-causing- Undef
    CF 6340heterozygoteVUS2 - Cis
    CF-causing - Trans
    CF 6555heterozygoteCF-causing- Undef
    CF 5148heterozygoteCF-causing - Trans
    CF 5746heterozygoteCF-causing - Trans
    CF 6353heterozygoteVUS2 - Cis
    CF-causing - Trans
    CF 6544heterozygotevarying clinical consequence- Undef
    CF 1014heterozygoteCF-causing - Trans
    CF 1016heterozygoteCF-causing - Trans
    CF 1018heterozygoteVUS3 - Trans
    CF 1019heterozygotevarying clinical consequence- Undef
    CF 1021heterozygoteCF-causing - Trans
    CF 1022heterozygoteCF-causing - Trans
    CF 1026heterozygoteCF-causing - Trans
    CF 1027heterozygoteCF-causing - Trans
    CF 4775heterozygoteCF-causing- Undef
    CF 4778heterozygotevarying clinical consequence - Trans
    CF 1031heterozygoteCF-causing - Trans
    CF 4781heterozygoteCF-causing - Trans
    VUS3- Undef
    CF 4782heterozygotevarying clinical consequence - Trans
    CF 4784heterozygoteCF-causing- Undef
    CF 1041heterozygoteCF-causing - Trans
    CF 4785heterozygotevarying clinical consequence- Undef
    CF 1042heterozygoteCFTR-RD-causing - Trans
    CF-causing- Undef
    CF 1045heterozygoteCF-causing - Trans
    CF 1047heterozygoteCF-causing - Trans
    CF 4788heterozygotevarying clinical consequence - Trans
    CF 4791heterozygoteCF-causing - Trans
    VUS3- Undef
    CF 4793heterozygoteCF-causing- Undef
    CF 4797heterozygoteCF-causing - Trans
    CF 5185heterozygoteCF-causing - Trans
    VUS3- Undef
    CF 5186heterozygotevarying clinical consequence - Trans
    VUS3- Undef
    CF 1071heterozygotevarying clinical consequence - Trans
    CF 5189heterozygotevarying clinical consequence - Trans
    VUS3- Undef
    CF 1085heterozygoteCF-causing - Trans
    CF 1086heterozygoteCF-causing- Undef
    CF 1092heterozygoteCF-causing- Undef
    CF 1093heterozygoteCF-causing - Trans
    CF 1095heterozygoteCF-causing - Trans
    CF 1100heterozygoteCF-causing - Trans
    CF 1101heterozygoteCF-causing - Trans
    VUS3- Undef
    CF 1107heterozygoteCF-causing - Trans
    CF 1119heterozygoteCF-causing- Undef
    CF 1121heterozygoteCF-causing - Trans
    CF 1125heterozygoteCF-causing - Trans
    CF 1133heterozygoteCF-causing - Trans
    CF 1137heterozygoteCF-causing - Trans
    CF 1139heterozygoteCF-causing - Trans
    CF 1140heterozygoteCF-causing - Trans
    CF 1142heterozygoteCF-causing - Trans
    CF 1146heterozygoteCF-causing - Trans
    CF 1148heterozygoteCF-causing - Trans
    CF 1151heterozygoteVUS3- Undef
    CF 1152heterozygoteCF-causing - Trans
    CF 1153heterozygoteCF-causing - Trans
    CF 1157heterozygoteCF-causing - Trans
    CF 1159heterozygoteCF-causing - Trans
    CF 1160heterozygoteCF-causing - Trans
    CF 1165heterozygoteCF-causing - Trans
    CF 1166heterozygoteCF-causing- Undef
    CF 1172heterozygoteCF-causing - Trans
    CF 1173heterozygoteCF-causing - Trans
    CF 1178heterozygoteCF-causing - Trans
    CF 1186heterozygoteCF-causing - Trans
    CF 1187heterozygoteCF-causing - Trans
    CF 1190heterozygoteCF-causing - Trans
    CF 1191heterozygoteCF-causing - Trans
    CF 1192heterozygoteCF-causing - Trans
    CF 1193heterozygoteCF-causing - Trans
    CF 1205heterozygote
    CF 1223heterozygoteCF-causing - Trans
    CF 1226heterozygoteCF-causing- Undef
    CF 1227heterozygoteCF-causing - Trans
    CF 1228heterozygoteCF-causing - Trans
    CF 1232heterozygotevarying clinical consequence- Undef
    CF 1233heterozygotevarying clinical consequence- Undef
    CF 1238heterozygotevarying clinical consequence - Trans
    CF 1241heterozygoteCF-causing- Undef
    CF 1258heterozygoteCF-causing - Trans
    CF 1259heterozygotevarying clinical consequence- Undef
    CF 1266heterozygoteCF-causing - Trans
    CF 1273heterozygotevarying clinical consequence - Trans
    CF 1278heterozygoteCF-causing- Undef
    CF 1279heterozygotevarying clinical consequence - Trans
    CF 1299heterozygoteCF-causing- Undef
    CF 1300heterozygote
    CF 1303heterozygoteCF-causing- Undef
    CF 1304heterozygoteCF-causing- Undef
    CF 1306heterozygoteCF-causing - Trans
    CF 1309heterozygotevarying clinical consequence- Undef
    CF 1310heterozygotevarying clinical consequence- Undef
    CF 1311heterozygotevarying clinical consequence - Trans
    CF 1315heterozygoteCF-causing - Trans
    CF 4847heterozygotevarying clinical consequence- Undef
    CF 4853heterozygoteCF-causing - Trans
    CF 4865heterozygotevarying clinical consequence- Undef
    CF 4862heterozygotevarying clinical consequence- Undef
    CF 4864heterozygotevarying clinical consequence- Undef
    CF 4858heterozygotevarying clinical consequence- Undef
    CF 4855heterozygoteVUS3- Undef
    CF 4860heterozygotevarying clinical consequence- Undef
    CF 4856heterozygoteCF-causing- Undef
    CF 4854heterozygoteCF-causing - Trans
    CF 4859heterozygoteCF-causing - Trans
    CF 4861heterozygoteCFTR-RD-causing - Trans
    VUS3 - Trans
    CF 4872heterozygoteCF-causing- Undef
    CF 4871heterozygotevarying clinical consequence - Trans
    CF 1440heterozygotevarying clinical consequence- Undef
    CF 1515heterozygoteCF-causing - Trans
    CF 1516heterozygoteVUS2- Undef
    CF 1518heterozygotelikely CF - Trans
    CF 1520heterozygoteCF-causing - Trans
    CF 1526heterozygoteCF-causing - Trans
    CF 1527heterozygoteCFTR-RD-causing - Trans
    CF 1531heterozygoteCF-causing - Trans
    CF 1532heterozygoteCF-causing- Undef
    CF 1533heterozygoteCF-causing - Trans
    CF 1536heterozygoteCF-causing- Undef
    CF 1538heterozygoteCF-causing - Trans
    CF 1539heterozygote
    CF 1540heterozygotevarying clinical consequence- Undef
    CF 1541heterozygotevarying clinical consequence- Undef
    CF 1543heterozygotevarying clinical consequence- Undef
    CF 1545heterozygotevarying clinical consequence - Trans
    CF 1546heterozygote
    CF 1549heterozygoteCFTR-RD-causing - Trans
    CF-causing - Trans
    CF 1550heterozygoteCF-causing - Trans
    CF 1553heterozygoteCF-causing - Trans
    CF 1556heterozygoteCF-causing - Trans
    CF 1559heterozygoteCF-causing- Undef
    CF 1562heterozygoteCFTR-RD-causing - Trans
    CF 1567heterozygoteCF-causing - Trans
    CF 1570heterozygotevarying clinical consequence - Trans
    CF 1571heterozygoteCFTR-RD-causing - Trans
    CF 1572heterozygoteCF-causing - Trans
    CF 1573heterozygoteCF-causing - Trans
    CF 1577heterozygoteCF-causing - Trans
    CF 1578heterozygoteCF-causing - Trans
    CF 1579heterozygoteCF-causing- Undef
    CF 1581heterozygoteCF-causing - Trans
    CF 1583heterozygoteCF-causing - Trans
    CF 1584heterozygoteCF-causing - Trans
    CF 1585heterozygoteCF-causing- Undef
    CF 5434heterozygoteVUS3 - Trans
    CF 5713heterozygotelikely CF- Undef
    CF 1589heterozygoteCF-causing- Undef
    CF 1593heterozygoteCF-causing- Undef
    CF 1596heterozygoteCF-causing- Undef
    CF 1598heterozygoteCF-causing- Undef
    CF 1600heterozygoteCF-causing- Undef
    CF 1604heterozygoteCF-causing- Undef
    CF 1605heterozygoteCF-causing- Undef
    CF 1610heterozygotevarying clinical consequence- Undef
    CF 1612heterozygoteCF-causing- Undef
    CF 1614heterozygoteCF-causing- Undef
    CF 1629heterozygoteCF-causing- Undef
    CF 1638heterozygoteCF-causing- Undef
    CF 1642heterozygoteCF-causing- Undef
    CF 1653heterozygoteCF-causing- Undef
    CF 1654heterozygoteCF-causing- Undef
    CF 1657heterozygoteCF-causing- Undef
    CF 1658heterozygotevarying clinical consequence- Undef
    CF 1665heterozygoteCF-causing- Undef
    CF 1666heterozygoteCF-causing- Undef
    CF 1667heterozygotevarying clinical consequence- Undef
    CF 1677heterozygoteCF-causing- Undef
    CF 1678heterozygoteCF-causing- Undef
    CF 1683heterozygoteCF-causing- Undef
    CF 1684heterozygoteCF-causing- Undef
    CF 1685heterozygoteCF-causing- Undef
    CF 1686heterozygoteCF-causing - Trans
    CF 1689heterozygoteCF-causing- Undef
    CF 1690heterozygoteCF-causing- Undef
    CF 1692heterozygoteCF-causing- Undef
    CF 1693heterozygotevarying clinical consequence- Undef
    CF 1697heterozygoteCF-causing- Undef
    CF 1700heterozygoteCF-causing- Undef
    CF 1701heterozygoteCF-causing- Undef
    CF 1702heterozygotevarying clinical consequence- Undef
    CF 1704heterozygoteCF-causing- Undef
    CF 1707heterozygoteCF-causing- Undef
    CF 1710heterozygoteCF-causing- Undef
    CF 1714heterozygoteCF-causing- Undef
    CF 1717heterozygoteCF-causing- Undef
    CF 1718heterozygotevarying clinical consequence- Undef
    CF 1736heterozygoteCF-causing- Undef
    CF 1737heterozygoteCF-causing- Undef
    CF 1738heterozygoteCF-causing- Undef
    CF 1740heterozygoteCF-causing- Undef
    CF 1743heterozygotevarying clinical consequence- Undef
    CF 1744heterozygoteCF-causing- Undef
    CF 1749heterozygoteCF-causing- Undef
    CF 1753heterozygoteCF-causing- Undef
    CF 1757heterozygoteVUS3- Undef
    CF 1758heterozygoteVUS3- Undef
    CF 1760heterozygoteCF-causing- Undef
    CF 1762heterozygoteCF-causing- Undef
    CF 1770heterozygoteCF-causing- Undef
    CF 1771heterozygotevarying clinical consequence- Undef
    CF 1775heterozygoteCF-causing- Undef
    CF 1778heterozygoteCF-causing- Undef
    CF 1779heterozygoteCF-causing- Undef
    CF 1782heterozygoteCF-causing- Undef
    CF 1787heterozygoteCF-causing - Trans
    CF 1788heterozygoteCF-causing- Undef
    CF 1789heterozygoteCF-causing- Undef
    CF 1790heterozygoteCF-causing- Undef
    CF 4968heterozygoteCFTR-RD-causing - Trans
    CF 4970heterozygotevarying clinical consequence - Trans
    CF 4973heterozygoteCFTR-RD-causing- Undef
    CF 4983heterozygoteCF-causing- Undef
    CF 4985heterozygoteCF-causing- Undef
    CF 4986heterozygoteCF-causing- Undef
    CF 5468heterozygotelikely CF - Trans
    CF 5899heterozygotevarying clinical consequence - Trans
    CF 4995heterozygoteVUS3 - Cis
    VUS3 - Cis
    VUS3 - Trans
    CF 4999heterozygotevarying clinical consequence- Undef
    CF 1800heterozygotevarying clinical consequence- Undef
    CF 1807heterozygotevarying clinical consequence- Undef
    CF 1814heterozygoteCF-causing- Undef
    CF 5023heterozygoteCF-causing- Undef
    CF 5033heterozygoteCF-causing- Undef
    CF 5469heterozygotevarying clinical consequence- Undef
    CF 5036heterozygoteCF-causing- Undef
    CF 5038heterozygoteVUS3- Undef
    CF 5040heterozygoteCFTR-RD-causing- Undef
    CF 5041heterozygotevarying clinical consequence- Undef
    CF 2234heterozygoteCF-causing- Undef
    CF 5045heterozygoteCF-causing- Undef
    CF 5053heterozygoteVUS3- Undef
    CF 5057heterozygoteCF-causing- Undef
    CF 1819heterozygotevarying clinical consequence- Undef
    CF 1822heterozygoteCF-causing- Undef
    CF 1824heterozygoteCF-causing- Undef
    CF 1826heterozygoteCF-causing- Undef
    CF 1834heterozygoteCF-causing- Undef
    CF 1837heterozygoteCF-causing- Undef
    CF 1838heterozygoteCF-causing- Undef
    CF 1839heterozygoteCF-causing- Undef
    CF 1842heterozygoteCF-causing- Undef
    CF 1849heterozygoteCF-causing- Undef
    CF 1852heterozygoteCF-causing- Undef
    CF 1854heterozygotelikely CF- Undef
    CF 1857heterozygoteCF-causing- Undef
    CF 5284heterozygotevarying clinical consequence- Undef
    CF 5098heterozygoteCF-causing- Undef
    CF 5292heterozygoteCF-causing - Trans
    CF 5101heterozygoteCF-causing - Trans
    CF 5300heterozygoteCF-causing- Undef
    CF 5104heterozygotelikely CFTR-RD - Trans
    CF 5105heterozygoteCFTR-RD-causing- Undef
    CF 5107heterozygoteCF-causing - Trans
    CF 5114heterozygoteCF-causing- Undef
    CF 1859heterozygoteCF-causing- Undef
    CF 1861heterozygoteCF-causing- Undef
    CF 1863heterozygoteCF-causing- Undef
    VUS3- Undef
    CF 1867heterozygotevarying clinical consequence- Undef
    CF 1873heterozygoteCF-causing- Undef
    CF 1877heterozygoteCF-causing- Undef
    CF 1881heterozygoteCF-causing- Undef
    CF 1883heterozygoteCF-causing- Undef
    CF 1884heterozygotevarying clinical consequence- Undef
    CF 1885heterozygoteCF-causing- Undef
    CF 1886heterozygoteCF-causing- Undef
    CF 1888heterozygoteCF-causing- Undef
    CF 1889heterozygoteCF-causing- Undef
    CF 1890heterozygoteCF-causing- Undef
    CF 1894heterozygotevarying clinical consequence - Trans
    CF 1896heterozygoteCF-causing- Undef
    CF 1897heterozygoteCF-causing- Undef
    CF 1898heterozygoteCF-causing- Undef
    CF 1903heterozygoteCF-causing- Undef
    CF 1909heterozygoteCF-causing- Undef
    CF 1913heterozygoteCF-causing- Undef
    CF 1916heterozygoteCF-causing- Undef
    CF 1918heterozygoteCF-causing- Undef
    CF 5370heterozygoteCF-causing- Undef
    CF 5374heterozygoteCFTR-RD-causing - Trans
    non-CF - Trans
    CF-causing - Trans
    CF 5384heterozygoteCF-causing - Trans
    CF 5385heterozygoteCF-causing - Trans
    CF 5389heterozygoteCF-causing- Undef
    CF 5390heterozygoteCF-causing- Undef
    CF 5391heterozygoteCFTR-RD-causing- Undef
    CF 5440heterozygoteCF-causing- Undef
    CF 5441heterozygoteCF-causing - Trans
    CF 5448heterozygoteCF-causing- Undef
    CF 5462heterozygoteVUS3- Undef
    CF 5670heterozygoteVUS3 - Trans
    CF 5674heterozygoteCF-causing - Trans
    CF 5676heterozygoteCF-causing - Trans
    CF 5699heterozygotevarying clinical consequence- Undef
    CF 5861heterozygoteCF-causing - Trans
    CF 5863heterozygotevarying clinical consequence- Undef
    CF 5876heterozygoteVUS3 - Trans
    CF 5880heterozygoteCF-causing- Undef
    CF 5881heterozygoteCF-causing - Trans
    CF 5885heterozygoteCF-causing - Trans
    CF 5886heterozygoteCF-causing- Undef
    CF 5893heterozygoteCF-causing - Trans
    CF 6219heterozygotevarying clinical consequence - Trans
    CF 6227heterozygoteVUS3- Undef
    CF 6252heterozygoteCF-causing - Trans
    CF 6254heterozygoteVUS2 - Cis
    CF-causing - Trans
    CF 6268heterozygoteCF-causing - Trans
    CF 6281heterozygotevarying clinical consequence- Undef
    CF 6404heterozygoteVUS2 - Cis
    CF-causing- Undef
    CF 6407heterozygoteVUS3 - Trans
    CF-causing - Trans
    CF 1927heterozygoteCF-causing- Undef
    CF 1928heterozygoteCF-causing- Undef
    CF 1929heterozygoteCF-causing- Undef
    CF 1931heterozygoteCF-causing- Undef
    CF 1932heterozygoteCF-causing- Undef
    CF 1933heterozygoteCF-causing- Undef
    CF 1934heterozygoteCF-causing- Undef
    CF 1936heterozygoteCF-causing- Undef
    CF 1939heterozygoteCF-causing- Undef
    CF 1943heterozygoteCF-causing - Trans
    CF 1944heterozygoteCF-causing- Undef
    CF 1948heterozygoteCF-causing - Trans
    CF 1956heterozygotevarying clinical consequence- Undef
    CF 1958heterozygoteCF-causing- Undef
    CF 1959heterozygoteCF-causing- Undef
    CF 1964heterozygoteCFTR-RD-causing - Trans
    CF 1965heterozygoteCF-causing- Undef
    CF 1966heterozygotevarying clinical consequence- Undef
    CF 1970heterozygotevarying clinical consequence- Undef
    CF 1973heterozygoteCF-causing- Undef
    CF 1974heterozygoteCF-causing- Undef
    CF 1976heterozygoteCF-causing- Undef
    CF 1978heterozygoteCF-causing- Undef
    CF 1986heterozygoteCF-causing- Undef
    CF 1987heterozygoteCF-causing- Undef
    CF 1991heterozygoteCF-causing- Undef
    CF 1994heterozygoteCF-causing- Undef
    CF 1995heterozygoteCF-causing- Undef
    CF 1997heterozygoteCF-causing- Undef
    CF 1998heterozygoteCF-causing- Undef
    CF 2001heterozygoteCF-causing- Undef
    CF 2008heterozygoteCF-causing- Undef
    CF 2013heterozygotevarying clinical consequence- Undef
    CF 2016heterozygotevarying clinical consequence- Undef
    CF 2023heterozygotevarying clinical consequence- Undef
    CF 2035heterozygoteCF-causing- Undef
    CF 2045heterozygoteCFTR-RD-causing- Undef
    CF 2046heterozygoteCF-causing- Undef
    CF 2048heterozygoteCF-causing- Undef
    CF 2050heterozygotevarying clinical consequence- Undef
    CF 2051heterozygoteCF-causing- Undef
    CF 2052heterozygoteCF-causing- Undef
    CF 2053heterozygoteCF-causing- Undef
    VUS3- Undef
    CF 2056heterozygoteCF-causing- Undef
    CF 2062heterozygoteCF-causing- Undef
    CF 2066heterozygoteCF-causing- Undef
    CF 2072heterozygotevarying clinical consequence- Undef
    CF 2076heterozygoteCF-causing- Undef
    CF 2077heterozygotevarying clinical consequence- Undef
    CF 2081heterozygoteCF-causing- Undef
    CF 2082heterozygoteCF-causing- Undef
    CF 2083heterozygoteCF-causing- Undef
    CF 2088heterozygotevarying clinical consequence- Undef
    CF 2089heterozygoteCF-causing- Undef
    CF 2094heterozygoteCF-causing- Undef
    CF 2097heterozygoteCF-causing- Undef
    CF 2105heterozygoteCF-causing- Undef
    CF 2111heterozygoteCF-causing- Undef
    CF 2112heterozygoteCF-causing- Undef
    CF 2121heterozygotevarying clinical consequence- Undef
    CF 2122heterozygoteCF-causing- Undef
    CF 2124heterozygoteCF-causing- Undef
    CF 2126heterozygoteCF-causing- Undef
    CF 2128heterozygoteCF-causing- Undef
    CF 2129heterozygoteCF-causing- Undef
    CF 2131heterozygotevarying clinical consequence- Undef
    CF 2146heterozygoteCF-causing- Undef
    CF 2148heterozygoteCF-causing- Undef
    CF 2153heterozygoteVUS3- Undef
    CF 2155heterozygoteCF-causing - Trans
    CF 2158heterozygoteCF-causing- Undef
    CF 2172heterozygoteCF-causing- Undef
    CF 2175heterozygotevarying clinical consequence- Undef
    CF 2176heterozygoteCF-causing- Undef
    CF 2177heterozygoteCF-causing- Undef
    CF 2179heterozygoteCF-causing- Undef
    CF 2182heterozygoteCFTR-RD-causing- Undef
    CF 2191heterozygoteCF-causing- Undef
    CF 2192heterozygoteCF-causing- Undef
    CF 2199heterozygoteCF-causing- Undef
    CF 2201heterozygoteCF-causing- Undef
    CF 2205heterozygoteCF-causing- Undef
    CF 2218heterozygoteVUS3- Undef
    CF 2219heterozygoteCF-causing- Undef
    CF 2220heterozygoteCF-causing- Undef
    CF 2226heterozygoteCF-causing- Undef
    CF 2227heterozygoteCF-causing- Undef
    CF 2231heterozygotevarying clinical consequence- Undef
    CF 2235heterozygoteCF-causing- Undef
    CF 2245heterozygotevarying clinical consequence- Undef
    CF 2246heterozygoteCF-causing- Undef
    CF 2247heterozygoteCF-causing- Undef
    CF 2250heterozygoteCF-causing- Undef
    CF 2253heterozygotevarying clinical consequence- Undef
    CF 2257heterozygoteCF-causing- Undef
    CF 2262heterozygoteVUS3 - Cis
    CF-causing - Trans
    CF 2269heterozygoteCF-causing- Undef
    CF 2274heterozygoteCF-causing - Trans
    CF 2276heterozygoteCF-causing - Trans
    CF 2281heterozygotevarying clinical consequence- Undef
    CF 2283heterozygotevarying clinical consequence- Undef
    CF 2323heterozygotevarying clinical consequence- Undef
    CF 2332heterozygoteCF-causing- Undef
    CF 2333heterozygoteCF-causing- Undef
    CF 2339heterozygoteCF-causing- Undef
    CF 2343heterozygoteCFTR-RD-causing - Trans
    CF 2349heterozygoteCF-causing- Undef
    CF 2350heterozygote
    CF 2361heterozygoteCF-causing- Undef
    CF 2362heterozygoteCF-causing- Undef
    CF 2363heterozygoteCF-causing- Undef
    CF 2376heterozygoteCF-causing- Undef
    CF 2380heterozygoteCF-causing- Undef
    CF 2381heterozygotevarying clinical consequence- Undef
    CF 2394heterozygoteCF-causing- Undef
    CF 2399heterozygoteCF-causing- Undef
    CF 2410heterozygoteCF-causing- Undef
    CF 2429heterozygoteCF-causing- Undef
    CF 2438heterozygoteCF-causing- Undef
    CF 2439heterozygoteCF-causing- Undef
    CF 2444heterozygoteCF-causing- Undef
    CF 2452heterozygotevarying clinical consequence- Undef
    CF 2458heterozygoteCF-causing- Undef
    CF 2459heterozygoteCF-causing- Undef
    CF 2467heterozygoteCF-causing- Undef
    CF 2469heterozygoteCF-causing- Undef
    CF 2472heterozygoteCF-causing- Undef
    CF 2478heterozygoteCF-causing- Undef
    CF 2479heterozygoteCF-causing- Undef
    CF 2480heterozygoteCF-causing- Undef
    CF 2482heterozygoteCF-causing- Undef
    CF 2489heterozygotevarying clinical consequence- Undef
    CF 2494heterozygoteCF-causing- Undef
    CF 2495heterozygoteCF-causing- Undef
    CF 2496heterozygotevarying clinical consequence- Undef
    CF 2499heterozygoteCF-causing- Undef
    CF 2510heterozygoteCF-causing- Undef
    CF 2517heterozygoteCF-causing- Undef
    CF 2519heterozygoteCF-causing- Undef
    CF 2524heterozygoteVUS3 - Trans
    CF 2534heterozygoteCF-causing- Undef
    CF 2537heterozygoteCF-causing- Undef
    CF 2545heterozygoteCF-causing- Undef
    CF 2548heterozygoteCF-causing- Undef
    CF 2550heterozygoteCF-causing- Undef
    CF 2555heterozygoteCF-causing- Undef
    CF 2557heterozygotelikely CFTR-RD - Trans
    VUS3 - Trans
    CF 2558heterozygotelikely CFTR-RD - Trans
    VUS3 - Trans
    CF 2560heterozygoteCF-causing- Undef
    CF 2563heterozygoteCF-causing - Trans
    CF 2568heterozygoteCF-causing- Undef
    CF 2575heterozygoteCF-causing- Undef
    CF 2576heterozygotevarying clinical consequence- Undef
    CF 2589heterozygoteCF-causing- Undef
    CF 4878heterozygotevarying clinical consequence- Undef
    CF 2597heterozygotevarying clinical consequence- Undef
    CF-causing- Undef
    CF 2598heterozygoteCF-causing- Undef
    CF 4882heterozygoteCF-causing - Trans
    CF 2600heterozygoteCF-causing- Undef
    CF 4885heterozygoteCF-causing- Undef
    CF 4892heterozygotevarying clinical consequence - Cis
    varying clinical consequence - Trans
    CF 4893heterozygoteVUS3 - Trans
    CFTR-RD-causing- Undef
    VUS3- Undef
    CF 4895heterozygotevarying clinical consequence- Undef
    CF 2601heterozygoteCF-causing- Undef
    CF 2602heterozygoteCF-causing- Undef
    CF 4900heterozygote
    CF 4904heterozygoteCF-causing- Undef
    CF 4909heterozygoteCF-causing - Trans
    CF 4914heterozygoteVUS2 - Cis
    varying clinical consequence - Trans
    CF 2604heterozygoteCF-causing - Trans
    CF 4924heterozygotevarying clinical consequence - Trans
    CF 2607heterozygoteCF-causing- Undef
    CF 2608heterozygoteCF-causing- Undef
    CF 4903heterozygoteVUS3 - Trans
    CFTR-RD-causing- Undef
    VUS3- Undef
    CF 2610heterozygoteCF-causing- Undef
    CF 4936heterozygoteCF-causing- Undef
    CF 4938heterozygoteCF-causing - Trans
    CF 4939heterozygoteCF-causing- Undef
    CF 4940heterozygoteCF-causing- Undef
    CF 4943heterozygoteCF-causing- Undef
    CF 2616heterozygoteCF-causing- Undef
    CF 4946heterozygoteCF-causing - Trans
    VUS2- Undef
    CF 2620heterozygotevarying clinical consequence- Undef
    CF 2622heterozygoteCF-causing- Undef
    CF 4950heterozygoteCF-causing - Trans
    CF 4952heterozygotevarying clinical consequence- Undef
    CF 2624heterozygoteCF-causing- Undef
    CF 2627heterozygoteCF-causing- Undef
    CF 2630heterozygotevarying clinical consequence- Undef
    CF 2639heterozygoteCF-causing- Undef
    CF 2642heterozygoteCF-causing- Undef
    CF 2644heterozygoteCF-causing - Trans
    CF 2645heterozygoteCF-causing- Undef
    CF 2648heterozygoteCF-causing- Undef
    CF 2651heterozygoteCF-causing- Undef
    CF 2654heterozygotevarying clinical consequence- Undef
    CF 2655heterozygotevarying clinical consequence- Undef
    CF 2656heterozygoteVUS2- Undef
    CF 2658heterozygoteCF-causing- Undef
    CF 2660heterozygoteCF-causing- Undef
    CF 2661heterozygoteVUS3- Undef
    CF 2666heterozygoteCF-causing- Undef
    CF 2669heterozygoteCF-causing- Undef
    CF 2673heterozygoteVUS3- Undef
    VUS3- Undef
    CF 2678heterozygoteCF-causing- Undef
    CF 5709heterozygoteCF-causing - Trans
    CF 5091heterozygoteCF-causing - Trans
    CF 5116heterozygotevarying clinical consequence - Trans
    CF 5090heterozygoteCF-causing - Trans
    CF 5898heterozygotevarying clinical consequence - Trans
    CF 2679heterozygoteCF-causing- Undef
    CF 2680heterozygoteCF-causing- Undef
    CF 2684heterozygotevarying clinical consequence- Undef
    CF 2688heterozygoteCF-causing - Trans
    CF 2694heterozygoteCF-causing- Undef
    CF 2701heterozygotevarying clinical consequence- Undef
    CF 2712heterozygoteCF-causing - Trans
    CF 2717heterozygotevarying clinical consequence - Trans
    CF 2719heterozygoteCF-causing - Trans
    CF 2722heterozygoteCF-causing - Trans
    CF 2724heterozygotevarying clinical consequence- Undef
    CF 2732heterozygotevarying clinical consequence- Undef
    CF 2733heterozygotevarying clinical consequence - Trans
    CF 2735heterozygoteCFTR-RD-causing - Trans
    CF-causing - Trans
    CF 2739heterozygoteCF-causing - Trans
    CF 2741heterozygoteCF-causing - Trans
    CF 2744heterozygoteCF-causing - Trans
    CF 2752heterozygote
    CF 2754heterozygoteCF-causing - Trans
    CF 2755heterozygoteCF-causing - Trans
    CF 2758heterozygoteCF-causing - Trans
    CF 2761heterozygoteCF-causing - Trans
    CF 2764heterozygotevarying clinical consequence- Undef
    CF 2767heterozygoteCF-causing - Trans
    CF 2769heterozygoteCF-causing - Trans
    CF 2770heterozygoteCF-causing - Trans
    CF 2772heterozygoteCF-causing - Trans
    CF 2773heterozygoteCF-causing - Trans
    CF 2775heterozygoteCF-causing- Undef
    CF 2778heterozygoteCF-causing- Undef
    CF 2779heterozygoteCF-causing- Undef
    CF 2782heterozygoteCF-causing- Undef
    CF 2783heterozygoteCF-causing - Trans
    CF 2789heterozygoteCF-causing - Trans
    CF 2795heterozygoteCF-causing - Trans
    CF 2796heterozygotevarying clinical consequence - Trans
    CF 2797heterozygoteCF-causing - Trans
    CF 2799heterozygoteCF-causing- Undef
    CF 2804heterozygoteCF-causing - Trans
    CF 2807heterozygotevarying clinical consequence - Trans
    CF 2809heterozygotevarying clinical consequence- Undef
    CF 2812heterozygoteCF-causing - Trans
    CF 2818heterozygoteCF-causing - Trans
    CF 2821heterozygotevarying clinical consequence - Trans
    CF 2826heterozygoteCF-causing - Trans
    CF 2827heterozygotevarying clinical consequence - Trans
    CF 2828heterozygoteCF-causing - Trans
    CF 5014heterozygoteCF-causing - Trans
    CF-causing - Trans
    CF 2830heterozygoteCF-causing - Trans
    CF 5067heterozygotevarying clinical consequence - Trans
    CF 2837heterozygotevarying clinical consequence - Trans
    CF 2842heterozygotevarying clinical consequence - Trans
    CF 2844heterozygoteCF-causing - Trans
    CF 2848heterozygotevarying clinical consequence - Trans
    CF 2850heterozygoteCFTR-RD-causing - Trans
    CF-causing - Trans
    CF 2854heterozygoteCFTR-RD-causing - Trans
    CF-causing - Trans
    CF 2856heterozygoteCF-causing- Undef
    CF 2857heterozygoteCF-causing - Trans
    CF 2859heterozygoteCF-causing - Trans
    CF 2861heterozygotevarying clinical consequence - Trans
    CF 2862heterozygoteCF-causing - Trans
    CF 2864heterozygoteCF-causing - Trans
    CF 2865heterozygoteCF-causing - Trans
    CF 2870heterozygoteCF-causing - Trans
    CF 2879heterozygotevarying clinical consequence - Trans
    CF 2882heterozygotevarying clinical consequence- Undef
    CF 2883heterozygoteCF-causing - Trans
    CF 2884heterozygoteCF-causing - Trans
    CF 2888heterozygoteCF-causing - Trans
    CF 2889heterozygoteVUS3- Undef
    VUS3- Undef
    CF 2891heterozygote
    CF 2893heterozygoteCF-causing- Undef
    VUS3- Undef
    CF 2897heterozygoteCF-causing - Trans
    CF 2899heterozygoteCF-causing - Trans
    CF 2901heterozygoteCF-causing - Trans
    CF 2903heterozygoteCF-causing - Trans
    CF 2904heterozygoteCF-causing - Trans
    CF 2911heterozygoteCF-causing - Trans
    CF 2921heterozygoteCF-causing - Trans
    CF 2932heterozygotevarying clinical consequence - Trans
    CF 2937heterozygotevarying clinical consequence - Trans
    CF 2938heterozygotevarying clinical consequence - Trans
    CF 2939heterozygotevarying clinical consequence - Trans
    CF 2942heterozygotevarying clinical consequence- Undef
    CF 2950heterozygoteCF-causing - Trans
    CF 2957heterozygoteCF-causing- Undef
    CF 2961heterozygoteCF-causing - Trans
    CF 2962heterozygotevarying clinical consequence - Trans
    CF 2977heterozygoteCF-causing - Trans
    CF 2983heterozygotevarying clinical consequence - Trans
    CF 2996heterozygoteCF-causing - Trans
    CF 2998heterozygoteCFTR-RD-causing - Trans
    CF-causing - Trans
    CF 2999heterozygoteCF-causing - Trans
    CF 3000heterozygoteCF-causing - Trans
    CF 3001heterozygoteCF-causing - Trans
    CF 3007heterozygoteCF-causing - Trans
    CF 3008heterozygoteCF-causing- Undef
    CF 3010heterozygoteCF-causing - Trans
    CF 3018heterozygoteCF-causing - Trans
    CF 3021heterozygotevarying clinical consequence - Trans
    CF 3026heterozygoteVUS3 - Trans
    CF-causing - Trans
    CF 3027heterozygoteCF-causing - Trans
    CF 3029heterozygoteCF-causing - Trans
    CF 3034heterozygotevarying clinical consequence - Trans
    CF 3037heterozygoteCF-causing - Trans
    CF 3045heterozygoteCF-causing - Trans
    CF 3048heterozygoteCF-causing - Trans
    CF 3053heterozygoteCF-causing - Trans
    CF 3055heterozygoteCF-causing - Trans
    CF 3056heterozygoteCF-causing - Trans
    CF 3057heterozygoteCF-causing - Trans
    CF 4759heterozygoteCF-causing - Trans
    CF 3066heterozygoteCF-causing - Trans
    CF 3070heterozygoteCF-causing - Trans
    CF 3082heterozygoteCF-causing - Trans
    CF 3086heterozygoteCF-causing- Undef
    CF 5064heterozygoteCF-causing - Trans
    CF 3092heterozygotevarying clinical consequence- Undef
    CF 3101heterozygoteCF-causing - Trans
    CF 3103heterozygotevarying clinical consequence- Undef
    CF 3107heterozygotevarying clinical consequence- Undef
    CF 3108heterozygoteCF-causing - Trans
    CF 3115heterozygoteCF-causing - Trans
    CF 3116heterozygoteCF-causing - Trans
    CF 3119heterozygoteCF-causing - Trans
    CF 3123heterozygoteCF-causing - Trans
    CF 3124heterozygoteCF-causing- Undef
    CF 3127heterozygoteCF-causing - Trans
    CF 3131heterozygoteCFTR-RD-causing- Undef
    CF-causing- Undef
    CF 3132heterozygoteCF-causing - Trans
    CF 3134heterozygoteCF-causing - Trans
    CF 3137heterozygotevarying clinical consequence - Trans
    CF 3140heterozygoteCF-causing - Trans
    VUS3- Undef
    CF 3144heterozygoteCF-causing - Trans
    CF 3145heterozygoteCF-causing - Trans
    CF 3149heterozygoteCF-causing - Trans
    CF 3150heterozygoteCF-causing - Trans
    CF 3153heterozygoteCF-causing - Trans
    CF 3164heterozygoteCF-causing - Trans
    CF 3177heterozygoteCF-causing - Trans
    CF 3180heterozygoteCF-causing - Trans
    CF 3183heterozygoteCF-causing- Undef
    CF 3185heterozygoteCF-causing- Undef
    CF 3188heterozygoteCF-causing - Trans
    CF 3189heterozygoteCF-causing - Trans
    CF 3190heterozygoteCF-causing - Trans
    CF 3192heterozygoteCF-causing- Undef
    CF 3194heterozygoteCF-causing - Trans
    CF 3195heterozygoteCF-causing- Undef
    CF 3198heterozygoteCF-causing- Undef
    CF 3199heterozygoteCF-causing - Trans
    CF 3200heterozygoteCF-causing - Trans
    CF 3205heterozygoteCF-causing- Undef
    VUS3- Undef
    CF 3212heterozygotelikely CF- Undef
    CF 3215heterozygoteCF-causing- Undef
    CF 3216heterozygoteCF-causing- Undef
    CF 3217heterozygoteCF-causing - Trans
    CF 3218heterozygoteCF-causing- Undef
    CF 3222heterozygoteCF-causing - Trans
    CF 5066heterozygoteCF-causing - Trans
    CF 3227heterozygoteCF-causing - Trans
    CF 3229heterozygoteCF-causing- Undef
    CF 3239heterozygotevarying clinical consequence - Trans
    CF 3242heterozygoteCF-causing - Trans
    CF 3243heterozygoteCF-causing - Trans
    CF 3251heterozygoteCF-causing - Trans
    CF 3255heterozygoteCF-causing - Trans
    CF 3256heterozygoteCF-causing - Trans
    CF 3260heterozygoteCF-causing - Trans
    CF 3275heterozygoteCF-causing - Trans
    VUS3- Undef
    CF 3287heterozygotevarying clinical consequence - Trans
    CF 3289heterozygotevarying clinical consequence - Trans
    CF 3294heterozygoteCF-causing - Trans
    CF 3297heterozygoteCF-causing - Trans
    CF 3298heterozygotevarying clinical consequence - Trans
    CF 3302heterozygoteCF-causing - Trans
    CF 4629heterozygoteCF-causing - Trans
    VUS3- Undef
    CF 3308heterozygoteCF-causing - Trans
    CF 3320heterozygoteCF-causing - Trans
    CF 3328heterozygoteCF-causing - Trans
    CF 3330heterozygoteCF-causing - Trans
    CF 3336heterozygoteCF-causing - Trans
    CF 3337heterozygoteCF-causing - Trans
    CF 3347heterozygoteCF-causing - Trans
    CF 4764heterozygoteCF-causing- Undef
    CF 4744heterozygoteVUS3- Undef
    CF 4747heterozygoteCF-causing- Undef
    CF 3383heterozygoteCF-causing - Trans
    CF 3384heterozygoteCF-causing - Trans
    CF 5006heterozygoteCF-causing - Trans
    CF 3398heterozygoteCF-causing- Undef
    CF 3400heterozygoteCF-causing - Trans
    CF 3407heterozygoteCF-causing - Trans
    CF 3409heterozygotevarying clinical consequence - Trans
    CF 3410heterozygoteCF-causing - Trans
    CF 3413heterozygoteCF-causing - Trans
    CF 3418heterozygoteCF-causing - Trans
    CF 3419heterozygoteCF-causing - Trans
    CF 5174heterozygotevarying clinical consequence - Trans
    CF 5345heterozygotevarying clinical consequence - Trans
    CF 6439heterozygoteCF-causing - Trans
    CF 6453heterozygotevarying clinical consequence- Undef
    CF 5168heterozygoteCF-causing - Trans
    VUS3- Undef
    VUS3- Undef
    CF 5169heterozygoteCF-causing - Trans
    CF 5348heterozygoteCF-causing - Trans
    CF 5337heterozygoteCF-causing - Trans
    CF 5615heterozygoteCF-causing - Trans
    CF 5622heterozygotevarying clinical consequence - Trans
    CF 5767heterozygoteCF-causing- Undef
    CF 5948heterozygoteCF-causing - Trans
    CF 5963heterozygoteCF-causing - Trans
    CF 5965heterozygotevarying clinical consequence- Undef
    CF 5574heterozygoteVUS3 - Trans
    CF-causing - Trans
    CF 5335heterozygoteCF-causing - Trans
    CF 3426heterozygotevarying clinical consequence- Undef
    CF 3431heterozygoteCF-causing- Undef
    CF 3435heterozygoteCF-causing- Undef
    CF 3436heterozygoteCF-causing- Undef
    CF 3439heterozygoteCF-causing- Undef
    CF 3445heterozygoteCF-causing- Undef
    CF 3448heterozygoteCF-causing- Undef
    CF 3450heterozygoteCF-causing - Trans
    CF 3456heterozygoteCF-causing- Undef
    CF 3457heterozygoteCF-causing- Undef
    CF 3459heterozygoteCF-causing- Undef
    CF 3460heterozygoteCF-causing- Undef
    CF 3466heterozygotevarying clinical consequence- Undef
    CF 3467heterozygotevarying clinical consequence- Undef
    CF 3469heterozygoteCF-causing- Undef
    CF 3470heterozygoteCF-causing- Undef
    CF 3476heterozygoteCF-causing - Trans
    CF 3479heterozygotelikely CF - Trans
    CF 3481heterozygoteCF-causing- Undef
    CF 3485heterozygoteCF-causing- Undef
    CF 3486heterozygoteCF-causing- Undef
    CF 3487heterozygoteCF-causing- Undef
    CF 3488heterozygoteCF-causing- Undef
    CF 3489heterozygoteCF-causing- Undef
    CF 3490heterozygoteCF-causing- Undef
    CF 3491heterozygoteCF-causing- Undef
    CF 3493heterozygoteCF-causing- Undef
    CF 3495heterozygoteCF-causing - Trans
    CF 3498heterozygoteCF-causing - Trans
    CF 3501heterozygoteCF-causing- Undef
    CF 3502heterozygoteCF-causing- Undef
    CF 3503heterozygoteCF-causing- Undef
    CF 3506heterozygoteCF-causing- Undef
    CF 3507heterozygoteCF-causing- Undef
    CF 3509heterozygoteCF-causing - Trans
    CF 3513heterozygoteCF-causing- Undef
    CF 3518heterozygoteCF-causing - Trans
    CF 3523heterozygoteCF-causing- Undef
    CF 3524heterozygoteCF-causing- Undef
    CF 3525heterozygoteCF-causing - Trans
    CF 3526heterozygoteCF-causing- Undef
    CF 3532heterozygoteCF-causing - Trans
    CF 3544heterozygoteCF-causing- Undef
    CF 3545heterozygoteCF-causing - Trans
    CF 3546heterozygoteCF-causing - Trans
    CF 3547heterozygoteCF-causing - Trans
    CF 3549heterozygoteCF-causing- Undef
    CF 3556heterozygotevarying clinical consequence- Undef
    CF 3564heterozygoteCF-causing- Undef
    CF 3565heterozygoteCF-causing- Undef
    CF 3566heterozygoteCF-causing - Trans
    CF 3568heterozygoteCF-causing - Trans
    CF 3576heterozygoteCF-causing- Undef
    CF 3583heterozygoteCF-causing- Undef
    CF 3584heterozygoteCF-causing - Trans
    CF 3585heterozygoteCF-causing - Trans
    CF 3586heterozygoteCF-causing - Trans
    CF 3595heterozygoteCF-causing- Undef
    CF 3598heterozygoteCF-causing - Trans
    CF 3599heterozygoteCF-causing- Undef
    CF 3600heterozygoteCF-causing - Trans
    CF 3603heterozygoteCF-causing- Undef
    CF 3604heterozygoteCF-causing- Undef
    CF 3609heterozygoteCF-causing- Undef
    CF 3610heterozygoteCF-causing- Undef
    CF 3615heterozygoteCF-causing- Undef
    CF 3617heterozygoteCF-causing - Trans
    CF 3618heterozygoteCF-causing- Undef
    CF 3620heterozygoteCF-causing- Undef
    CF 3625heterozygotevarying clinical consequence- Undef
    CF 3626heterozygoteCF-causing- Undef
    CF 3629heterozygoteCF-causing - Trans
    CF 3630heterozygoteCF-causing - Trans
    CF 3635heterozygoteCF-causing - Trans
    CF 3639heterozygoteCF-causing - Trans
    CF 3641heterozygoteCF-causing- Undef
    CF 3646heterozygoteCF-causing - Trans
    CF 3647heterozygoteCF-causing - Trans
    CF 3649heterozygoteCF-causing- Undef
    CF 3653heterozygoteCF-causing- Undef
    CF 3654heterozygoteCF-causing - Trans
    CF 3656heterozygoteCF-causing- Undef
    CF 3661heterozygoteCF-causing- Undef
    CF 3664heterozygoteCF-causing- Undef
    CF 3666heterozygoteCF-causing- Undef
    CF 3678heterozygoteCF-causing - Trans
    CF 3679heterozygoteCF-causing - Trans
    CF 3680heterozygoteCF-causing- Undef
    CF 3684heterozygoteCF-causing- Undef
    CF 3685heterozygoteCF-causing - Trans
    CF 3688heterozygoteCF-causing- Undef
    CF 4965heterozygotevarying clinical consequence- Undef
    VUS3- Undef
    CF 3693heterozygoteCF-causing - Trans
    CF 3695heterozygoteCF-causing- Undef
    CF 3696heterozygoteCF-causing- Undef
    CF 3697heterozygoteCF-causing- Undef
    CF 3699heterozygote
    CF 3703heterozygoteCF-causing- Undef
    CF 3710heterozygoteCF-causing - Trans
    CF 3714heterozygoteCF-causing- Undef
    CF 3717heterozygoteCF-causing- Undef
    CF 3720heterozygoteCF-causing - Trans
    CF 3723heterozygoteCF-causing- Undef
    CF 3725heterozygoteCF-causing - Trans
    CF 3732heterozygoteCF-causing- Undef
    CF 3736heterozygoteCF-causing- Undef
    CF 3739heterozygoteCF-causing - Trans
    CF 3740heterozygoteCF-causing - Trans
    VUS3 - Trans
    CF 3741heterozygoteCF-causing - Trans
    CF 3743heterozygoteCF-causing - Trans
    CF 3745heterozygotevarying clinical consequence - Trans
    CF 3746heterozygoteCF-causing- Undef
    CF 3749heterozygoteCF-causing- Undef
    CF 3751heterozygoteCF-causing- Undef
    CF 3754heterozygoteCF-causing- Undef
    CF 3762heterozygoteCF-causing- Undef
    CF 3764heterozygoteCF-causing- Undef
    CF 3765heterozygoteCF-causing - Trans
    CF 3772heterozygoteCF-causing- Undef
    CF 3778heterozygoteCF-causing - Trans
    CF 3788heterozygotevarying clinical consequence- Undef
    CF 3792heterozygoteCF-causing - Trans
    CF 3795heterozygoteCF-causing- Undef
    CF 3797heterozygoteCF-causing- Undef
    CF 3801heterozygoteCF-causing- Undef
    CF 3808heterozygoteCF-causing - Trans
    CF 3820heterozygoteCF-causing- Undef
    CF 3822heterozygotevarying clinical consequence- Undef
    CF 3824heterozygoteCF-causing - Trans
    CF 3825heterozygoteCF-causing- Undef
    CF 3826heterozygoteCF-causing- Undef
    CF 3828heterozygoteCF-causing- Undef
    CF 3830heterozygoteCF-causing- Undef
    CF 3832heterozygoteCF-causing - Trans
    CF 3834heterozygoteCF-causing- Undef
    CF 3835heterozygoteCF-causing- Undef
    CF 3839heterozygoteCF-causing- Undef
    CF 3847heterozygoteVUS3- Undef
    CF 3848heterozygoteCF-causing- Undef
    CF 3850heterozygotevarying clinical consequence- Undef
    CF 3851heterozygoteCF-causing- Undef
    CF 3853heterozygoteCF-causing - Trans
    CF 3854heterozygoteCF-causing - Trans
    CF 3858heterozygoteCF-causing- Undef
    CF 3859heterozygoteCF-causing- Undef
    CF 3864heterozygoteCF-causing - Trans
    CF 3867heterozygoteCF-causing- Undef
    CF 3869heterozygoteCF-causing - Trans
    CF 3871heterozygoteCF-causing- Undef
    CF 3873heterozygoteCF-causing - Trans
    CF 3886heterozygoteCF-causing- Undef
    CF 3887heterozygoteCF-causing- Undef
    CF 3892heterozygoteCF-causing- Undef
    CF 3904heterozygoteCF-causing- Undef
    CF 3912heterozygoteCF-causing - Trans
    CF 3915heterozygoteCF-causing- Undef
    CF 3916heterozygoteCF-causing- Undef
    CF 3917heterozygotevarying clinical consequence - Trans
    CF 3921heterozygoteCF-causing- Undef
    CF 3934heterozygoteCF-causing - Trans
    CF 3936heterozygoteCF-causing- Undef
    CF 3937heterozygoteCF-causing- Undef
    CF 3940heterozygoteCF-causing - Trans
    CF 3944heterozygoteCF-causing- Undef
    CF 3952heterozygoteCF-causing- Undef
    CF 3953heterozygoteCF-causing- Undef
    CF 3956heterozygoteCF-causing- Undef
    CF 3960heterozygoteCF-causing- Undef
    CF 3965heterozygoteCF-causing- Undef
    CF 3966heterozygoteCF-causing- Undef
    CF 3969heterozygoteCF-causing - Trans
    CF 3973heterozygoteCF-causing- Undef
    CF 3985heterozygoteCF-causing- Undef
    CF 3988heterozygoteCF-causing - Trans
    CF 3990heterozygoteCF-causing - Trans
    CF 3994heterozygotevarying clinical consequence- Undef
    CF 3995heterozygoteCF-causing - Trans
    CF 4003heterozygoteCF-causing - Trans
    CF 4004heterozygoteCF-causing- Undef
    CF 4005heterozygoteCF-causing- Undef
    CF 4006heterozygoteCF-causing- Undef
    CF 4012heterozygoteCF-causing- Undef
    CF 4013heterozygoteCF-causing - Trans
    CF 4022heterozygoteCF-causing- Undef
    CF 4026heterozygoteCF-causing - Trans
    CF 5790heterozygotelikely CF- Undef
    CF 4028heterozygoteCF-causing - Trans
    CF 4038heterozygoteCF-causing- Undef
    CF 4040heterozygoteCF-causing- Undef
    CF 4044heterozygotevarying clinical consequence - Trans
    CF 4045heterozygoteCF-causing- Undef
    CF 4046heterozygoteCF-causing- Undef
    CF 4048heterozygoteCF-causing- Undef
    CF 4050heterozygoteCF-causing- Undef
    CF 4051heterozygoteCF-causing - Trans
    CF 4053heterozygoteCF-causing - Trans
    CF 4055heterozygoteCF-causing- Undef
    CF 4056heterozygoteCF-causing- Undef
    CF 4060heterozygoteCF-causing - Trans
    CF 4061heterozygoteCF-causing- Undef
    CF 4066heterozygoteCF-causing- Undef
    CF 4069heterozygoteCF-causing - Trans
    CF 4072heterozygoteVUS2- Undef
    CF 4074heterozygoteCF-causing- Undef
    CF 4076heterozygoteCF-causing- Undef
    CF 4079heterozygoteCF-causing- Undef
    CF 4080heterozygoteCF-causing- Undef
    CF 4083heterozygoteCF-causing- Undef
    CF 4087heterozygotevarying clinical consequence- Undef
    CF 4090heterozygoteCF-causing- Undef
    CF 4096heterozygoteCF-causing - Trans
    CF 4101heterozygoteCF-causing- Undef
    CF 4103heterozygoteCF-causing- Undef
    CF 4104heterozygoteCF-causing- Undef
    CF 4106heterozygoteCF-causing- Undef
    CF 4107heterozygoteCF-causing- Undef
    CF 4108heterozygoteCF-causing- Undef
    CF 4112heterozygoteCF-causing - Trans
    CF 4114heterozygoteCF-causing - Trans
    CF 4117heterozygoteCF-causing - Trans
    CF 4126heterozygoteCF-causing - Trans
    CF 4128heterozygotevarying clinical consequence - Trans
    CF 4129heterozygoteCF-causing- Undef
    CF 4133heterozygotevarying clinical consequence - Trans
    CF 4136heterozygoteCF-causing- Undef
    CF 4142heterozygotevarying clinical consequence - Trans
    CF 4143heterozygoteCF-causing - Trans
    CF 4144heterozygoteCF-causing - Trans
    CF 4150heterozygoteCF-causing- Undef
    CF 4157heterozygoteCF-causing- Undef
    CF 4160heterozygoteCF-causing - Trans
    CF 4167heterozygoteCF-causing- Undef
    CF 4171heterozygotevarying clinical consequence - Trans
    CF 4172heterozygoteCF-causing- Undef
    CF 4181heterozygoteCF-causing - Trans
    CF 4186heterozygoteCF-causing- Undef
    CF 4189heterozygoteCF-causing- Undef
    CF 4194heterozygoteCF-causing- Undef
    CF 4196heterozygoteCF-causing- Undef
    CF 5759heterozygoteCF-causing - Trans
    CF 4206heterozygoteCF-causing- Undef
    CF 4222heterozygoteCF-causing - Trans
    CF 4227heterozygoteCF-causing - Trans
    CF 4230heterozygoteVUS2 - Cis
    CF-causing - Trans
    CF 4236heterozygoteCFTR-RD-causing - Trans
    CF-causing - Trans
    CF 4251heterozygoteCF-causing - Trans
    CF 4254heterozygoteCF-causing- Undef
    CF 4267heterozygoteCF-causing - Trans
    CF 4268heterozygotevarying clinical consequence- Undef
    CF 4274heterozygoteCF-causing - Trans
    CF 4277heterozygoteCF-causing- Undef
    CF 4283heterozygoteCF-causing - Trans
    CF 4284heterozygoteCF-causing - Trans
    CF 4290heterozygoteCF-causing - Trans
    CF 4297heterozygoteCF-causing - Trans
    CF 4306heterozygoteCF-causing - Trans
    CF 4307heterozygoteCF-causing - Trans
    CF 4323heterozygoteCF-causing - Trans
    CF 4325heterozygotevarying clinical consequence - Trans
    CF 4804heterozygoteCF-causing- Undef
    CF 4807heterozygoteCF-causing- Undef
    CF 6314heterozygotevarying clinical consequence- Undef
    CF 6301heterozygoteVUS3 - Trans
    CF 4326heterozygoteCF-causing - Trans
    CF 6306heterozygoteCF-causing- Undef
    CF 6305heterozygotevarying clinical consequence- Undef
    CF 4329heterozygoteCF-causing - Trans
    CF 4335heterozygotelikely CF- Undef
    CF 4341heterozygoteVUS3 - Cis
    CF-causing - Trans
    CF 4344heterozygoteCF-causing- Undef
    CF 4347heterozygoteCF-causing - Trans
    CF 4348heterozygoteCF-causing- Undef
    CF 4349heterozygotevarying clinical consequence - Trans
    CF 4351heterozygotevarying clinical consequence- Undef
    CF 4357heterozygoteCF-causing- Undef
    CF 4360heterozygoteCF-causing- Undef
    CF 4361heterozygote
    CF 4363heterozygote
    CF 4364heterozygoteCF-causing - Trans
    CF 4365heterozygoteCF-causing - Trans
    CF 4368heterozygoteCF-causing - Trans
    CF 4376heterozygotevarying clinical consequence- Undef
    CF 4380heterozygoteCF-causing- Undef
    CF 4381heterozygoteCF-causing- Undef
    CF 4383heterozygoteCF-causing - Trans
    CF 4387heterozygoteCF-causing- Undef
    CF 4391heterozygoteCF-causing - Trans
    CF 4394heterozygoteCF-causing- Undef
    CF 4395heterozygoteCF-causing - Trans
    CF 4396heterozygoteCF-causing- Undef
    CF 4397heterozygoteCF-causing - Trans
    CF 4398heterozygoteCF-causing - Trans
    CF 4400heterozygoteCF-causing- Undef
    CF 4401heterozygotevarying clinical consequence - Trans
    CF 4406heterozygoteVUS2- Undef
    CF-causing- Undef
    CF 4413heterozygoteCF-causing - Trans
    CF 4417heterozygoteCF-causing - Trans
    CF 4427heterozygoteCF-causing - Trans
    CF 4432heterozygoteCF-causing - Trans
    CF 4435heterozygotevarying clinical consequence - Trans
    CF 4437heterozygoteCF-causing - Trans
    CF 4439heterozygoteCF-causing - Trans
    CF 4440heterozygoteCF-causing - Trans
    CF 4441heterozygoteCF-causing - Trans
    CF 4442heterozygoteCF-causing - Trans
    CF 4452heterozygoteCF-causing- Undef
    CF 4460heterozygoteCF-causing - Trans
    CF 4461heterozygoteCF-causing- Undef
    CF 4462heterozygoteVUS3 - Trans
    CF 4463heterozygotevarying clinical consequence - Trans
    CF 4464heterozygotevarying clinical consequence - Trans
    CF 4465heterozygoteCF-causing - Trans
    CF 4466heterozygoteCF-causing - Trans
    CF 4470heterozygoteCF-causing - Trans
    CF 4471heterozygoteCF-causing - Trans
    CF 4473heterozygoteCF-causing - Trans
    CF 4477heterozygoteCF-causing - Trans
    CF 4479heterozygotevarying clinical consequence - Trans
    CF 4481heterozygoteCF-causing- Undef
    CF 4482heterozygoteCF-causing - Trans
    VUS3- Undef
    CF 4483heterozygotevarying clinical consequence- Undef
    CF 4493heterozygoteCF-causing - Trans
    CF 4494heterozygoteCF-causing - Trans
    CF 4496heterozygoteCF-causing - Trans
    CF 4499heterozygotevarying clinical consequence - Trans
    CF 4502heterozygotevarying clinical consequence - Trans
    CF 4507heterozygoteCF-causing- Undef
    CF 4510heterozygoteCF-causing - Trans
    CF 4514heterozygoteCF-causing - Trans
    CF 4519heterozygoteCF-causing- Undef
    CF 4521heterozygoteCF-causing - Trans
    CF 4525heterozygoteCF-causing- Undef
    CF 4535heterozygoteCF-causing - Trans
    CF 4560heterozygotelikely CF- Undef
    CF 4580heterozygoteCF-causing - Trans
    CF 4585heterozygoteCF-causing - Trans
    CF 4591heterozygoteVUS2 - Trans
    CF 4594heterozygoteCF-causing - Trans
    VUS3- Undef
    CF 4596heterozygoteCF-causing - Trans
    CF 4605heterozygotevarying clinical consequence - Trans
    CF 4610heterozygoteCF-causing - Trans
    CF 6040heterozygoteCF-causing- Undef
    CF 6171heterozygoteCF-causing- Undef
    CF 6082heterozygotevarying clinical consequence- Undef
    CF 6102heterozygoteCF-causing - Trans
    CF 6085heterozygoteCF-causing- Undef
    CF 6086heterozygoteCF-causing - Trans
    CF 6165heterozygotelikely CF- Undef
    CF 6088heterozygoteCF-causing - Trans
    CF 6091heterozygoteCF-causing - Trans
    CF 6094heterozygoteCF-causing- Undef
    CF 6096heterozygotevarying clinical consequence- Undef
    CF 6484heterozygoteCF-causing- Undef
    CF 6481heterozygotevarying clinical consequence- Undef
    CF 6478heterozygoteCF-causing - Trans
    CF 6477heterozygoteCF-causing - Trans
    CF 6203heterozygotevarying clinical consequence- Undef
    CF 6177heterozygoteCF-causing- Undef
    CF 6168heterozygoteCF-causing - Trans
    CF 6202heterozygotevarying clinical consequence - Trans
    CF 6170heterozygoteCF-causing- Undef
    CF 6197heterozygotevarying clinical consequence- Undef
    CF 6162heterozygoteCF-causing - Trans
    CF 6106heterozygoteVUS3 - Trans
    CF 6159heterozygoteCF-causing - Trans
    CF 6181heterozygoteCF-causing - Trans
    CF 5993heterozygoteCFTR-RD-causing - Trans
    CF 6166heterozygoteCF-causing- Undef
    CF 6002heterozygoteVUS3 - Trans
    CF 6006heterozygotevarying clinical consequence- Undef
    CF 6005heterozygotevarying clinical consequence - Trans
    CF 6007heterozygoteCF-causing - Trans
    CF 6009heterozygotevarying clinical consequence- Undef
    CF 6013heterozygotevarying clinical consequence - Trans
    CF 6160heterozygoteCFTR-RD-causing - Trans
    varying clinical consequence - Trans
    CF 6016heterozygoteCF-causing- Undef
    CF 6018heterozygoteCF-causing - Trans
    CF 6164heterozygoteVUS3 - Trans
    CF 6021heterozygotelikely CF - Trans
    CF 6022heterozygoteVUS3 - Trans
    CF 6026heterozygoteCF-causing - Trans
    CF 6029heterozygoteCF-causing - Trans
    CF 6104heterozygoteCF-causing- Undef
    CF 6107heterozygoteCF-causing - Trans
    CF 6184heterozygotevarying clinical consequence - Trans
    CF 6110heterozygoteVUS3 - Trans
    CF 5282heterozygotevarying clinical consequence - Trans
    CF 6176heterozygoteCF-causing - Trans
    CF 6034heterozygotevarying clinical consequence - Trans
    CF 6036heterozygoteCF-causing- Undef
    CF 6109heterozygoteCF-causing - Trans
    CF 6163heterozygoteCF-causing- Undef
    CF 6023heterozygoteCF-causing- Undef
    CF 6108heterozygoteVUS3 - Trans
    CF 3184homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3187homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3196homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3197homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3202homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3203homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3207homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3211homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3214homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3220homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3225homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3226homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3230homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3237homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3244homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3248homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3249homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3250homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3252homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3254homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3258homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3263homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3278homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3283homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3285homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3296homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3299homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3304homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3319homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3340homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3342homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3345homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3348homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3350homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3356homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3358homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3359homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3379homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3380homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3386homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3389homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3393homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3406homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3412homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3417homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3420homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2766homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3421homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3422homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3423homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3424homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3425homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3427homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3428homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3429homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3430homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3432homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3434homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3440homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3443homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3444homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3446homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3447homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3449homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3451homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3452homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3454homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3455homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3462homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3463homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3464homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3468homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3471homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3473homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3474homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3475homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3480homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3482homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3483homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3484homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3494homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3496homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3497homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3499homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3500homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3508homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3510homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3511homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3514homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3515homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3516homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3517homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3519homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3520homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3521homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3522homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3527homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3528homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3529homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3530homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3531homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3533homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3534homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3535homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3537homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3538homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3541homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3542homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3543homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3550homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3551homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3552homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3553homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3554homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3557homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3558homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3559homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3560homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3561homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3562homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3563homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3567homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3569homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3572homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3573homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3577homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3580homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3581homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3582homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3588homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3592homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3593homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3594homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3596homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3597homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3601homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3602homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3605homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3606homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3607homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3611homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3612homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3613homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3614homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3616homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3619homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3622homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3623homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3624homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3627homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3631homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3632homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3633homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3634homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3636homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3637homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3638homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3640homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3642homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3643homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3644homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3645homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3650homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3651homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3652homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3657homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3659homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3662homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3665homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3669homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3670homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3671homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3673homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3675homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3681homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3683homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3686homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3687homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3689homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3690homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3691homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3694homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3700homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3701homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3702homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3704homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3705homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3706homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3708homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3709homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3711homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3712homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3715homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3716homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3718homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3719homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3721homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3722homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3726homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3727homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3729homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3730homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3731homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3733homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3735homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3738homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3742homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3744homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3748homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3750homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3752homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3753homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3756homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3758homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3761homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3767homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3768homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3769homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3774homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3779homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3780homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3781homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3782homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3783homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3785homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3786homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3789homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3790homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3791homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3793homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3796homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3799homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3800homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3802homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3804homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3805homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3806homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3807homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3811homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3812homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3813homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3814homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3815homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3818homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3819homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3821homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3827homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3829homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3831homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3833homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3836homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3837homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3838homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3840homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3841homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3843homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3844homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3845homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3846homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3849homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3852homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3855homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3856homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3857homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3860homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3863homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3866homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3868homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3870homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3874homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3878homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3879homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3880homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3882homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3883homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3885homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3888homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3889homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3890homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3891homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3893homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3894homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3895homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3896homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3897homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3898homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3899homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3900homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3902homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3903homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3906homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3907homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3910homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3911homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3913homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3914homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3918homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3920homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3922homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3923homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3924homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3927homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3928homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3929homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3931homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3932homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3933homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3935homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3938homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3939homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3941homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3942homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3943homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3945homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3946homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3947homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3948homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3949homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3950homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3954homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3955homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3957homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3961homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3962homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3963homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3964homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3967homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3968homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3970homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3971homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3972homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3974homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3975homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3976homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3977homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3979homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3981homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3983homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3984homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3986homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3987homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3991homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3992homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3993homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3996homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3997homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3998homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3999homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4000homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4001homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4002homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4007homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4008homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4009homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4011homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4015homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4016homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4017homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4021homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4023homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4025homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4027homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4029homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4031homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4032homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4033homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4034homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4036homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4037homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4039homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4041homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4049homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4057homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4059homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4065homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4067homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4068homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4070homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4071homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4073homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4077homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4081homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4082homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4084homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4085homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4088homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4089homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4092homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4093homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4094homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4095homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4097homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4100homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4102homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4110homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4111homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4116homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4118homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4120homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4121homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4124homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4125homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4127homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4131homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4132homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4134homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4135homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4138homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4139homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4140homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4141homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4147homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4148homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4149homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4151homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4152homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4153homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4154homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4155homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4156homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4158homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4161homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4162homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4163homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4168homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4170homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4175homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4176homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4177homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4178homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4179homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4183homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4184homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4187homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4188homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4190homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4191homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4192homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4195homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4197homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4198homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4199homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4200homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4201homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4203homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4204homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4205homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4208homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4209homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4210homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4211homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4212homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4213homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4214homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4216homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4217homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4219homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4220homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4221homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4245homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4272homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4281homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4282homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4294homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4302homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4328homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4330homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4334homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4342homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4346homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4350homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4352homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4353homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4355homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4356homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4362homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4366homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4367homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4369homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4370homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4371homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4372homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4373homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4374homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4377homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4378homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4382homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4385homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4388homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4389homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4392homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4393homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4402homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4403homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4404homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4405homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4412homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4423homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4424homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4425homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4426homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4428homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4429homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4430homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4433homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4436homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4438homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4444homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4445homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4446homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4447homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4448homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4449homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4450homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4451homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4454homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4455homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4456homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4457homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4459homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4467homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4468homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4469homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4475homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4478homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4490homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4491homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4492homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4495homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4497homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4498homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4500homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4501homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4504homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4506homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4509homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4511homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4527homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4603homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 5homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 9homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 10homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 13homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 15homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 18homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 20homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 21homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 24homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 29homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 30homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 31homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 34homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 35homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 40homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 42homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 44homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 48homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 49homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 50homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 54homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 55homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 56homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 58homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 60homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 66homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 67homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 71homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 72homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 74homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 75homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 77homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 78homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 84homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 85homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 93homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 104homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 106homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 108homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 115homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 116homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 118homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 125homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 134homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 135homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 142homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 144homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 150homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 155homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 189homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 191homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 192homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 226homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 235homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 241homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 250homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 256homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 260homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 268homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 273homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 278homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 279homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 296homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 300homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 301homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 302homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 311homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 325homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 329homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 337homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 339homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 342homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 345homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 364homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 376homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 378homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 388homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 415homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 442homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 457homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 487homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 554homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 563homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 568homozygotec.1521_1523del - p.(Phe508del) - Trans
    c.2770G>A - p.(Asp924Asn) - Trans
    CF 569homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 573homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 581homozygotec.1399C>T - p.(Leu467Phe) - Trans
    c.1521_1523del - p.(Phe508del) - Trans
    CF 585homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 587homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 592homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 593homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 595homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 603homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 606homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 608homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 610homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 618homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 624homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 628homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 629homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 630homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 634homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 635homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 638homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 667homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 670homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 673homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 685homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 694homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 699homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 700homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 708homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 709homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 713homozygotec.1399C>T - p.(Leu467Phe) - Trans
    c.1521_1523del - p.(Phe508del) - Trans
    CF 719homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 727homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 741homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 749homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 750homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 754homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 759homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 764homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 797homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 807homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 809homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 811homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 827homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 830homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 831homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 833homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 839homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 847homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 854homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 855homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 862homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 865homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 866homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 870homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 898homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 902homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 903homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 905homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 915homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 933homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 939homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 942homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 946homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 974homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 979homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 982homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 995homozygotec.1521_1523del - p.(Phe508del) - Trans
    c.3080T>C - p.(Ile1027Thr) - Trans
    CF 996homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1001homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1003homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1009homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 5355homozygotec.1521_1523del - p.(Phe508del) - Trans
    c.53+4A>T - p.(=) - Trans
    CF 1015homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1020homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1023homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4771homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4772homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1028homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1029homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 4779homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1032homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1033homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1034homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1035homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1037homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1038homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1039homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1043homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1046homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1049homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1051homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1053homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1054homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1058homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1060homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1079homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1080homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1084homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1102homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1104homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1105homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1106homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1108homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1111homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1112homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1115homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1122homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1127homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1129homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1135homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1143homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1144homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1145homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1147homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1149homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1154homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1156homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1162homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1167homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1175homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1176homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1179homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1182homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1183homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1188homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1194homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1195homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1198homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1200homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1202homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1204homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1207homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1208homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1209homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1210homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1213homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1214homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1215homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1216homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1218homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1219homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1221homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1229homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1249homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1275homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1282homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1523homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1548homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1552homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1582homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1587homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1588homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1591homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1592homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1594homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1595homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1599homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1601homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1602homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1603homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1607homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1609homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1611homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1613homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1615homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1617homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1619homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1621homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1624homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1625homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1626homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1633homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1636homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1637homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1641homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1643homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1645homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1646homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1647homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1648homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1649homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1651homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1661homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1670homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1671homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1675homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1681homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1687homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1688homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1694homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1695homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1708homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1709homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1711homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1715homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1719homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1721homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1723homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1726homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1727homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1730homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1731homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1732homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1733homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1734homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1739homozygotec.1521_1523del - p.(Phe508del) - Trans
    c.3080T>C - p.(Ile1027Thr) - Trans
    CF 1742homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1750homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1751homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1754homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1755homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1765homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1766homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1767homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1769homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1773homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1777homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1781homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1784homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1785homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1791homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1793homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1797homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1799homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1802homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1803homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1804homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1806homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1808homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1811homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1813homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1823homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1827homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1828homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1830homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1831homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1835homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1843homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1845homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1847homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1848homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1850homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1853homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1858homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1865homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1869homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1870homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1872homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1874homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1876homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1880homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1882homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1892homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1895homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1899homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1900homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1901homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1906homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1907homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1910homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1911homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1912homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1914homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1917homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1922homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1923homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1924homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1938homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1941homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1942homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1946homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1951homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1952homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1953homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1954homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1971homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1977homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1983homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1984homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1988homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1989homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1992homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1993homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 1996homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2002homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2003homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2010homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2012homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2018homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2019homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2020homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2024homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2027homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2028homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2030homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2031homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2034homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2041homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2043homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2047homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2049homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2054homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2057homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2058homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2063homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2064homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2068homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2069homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2070homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2074homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2079homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2085homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2087homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2092homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2093homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2102homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2103homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2104homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2106homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2107homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2113homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2115homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2116homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2117homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2123homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2130homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2133homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2135homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2136homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2143homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2144homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2145homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2149homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2151homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2152homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2157homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2160homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2161homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2163homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2164homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2166homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2167homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2169homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2171homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2173homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2180homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2184homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2186homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2187homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2190homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2194homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2196homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2200homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2206homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2207homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2209homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2213homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2215homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2223homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2224homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2230homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2233homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2236homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2237homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2239homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2240homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2251homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2256homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2259homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2267homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2268homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2270homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2271homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2272homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2278homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2282homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2284homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2288homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2290homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2293homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2294homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2295homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2296homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2309homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2310homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2316homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2317homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2320homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2328homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2331homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2335homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2341homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2345homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2352homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2359homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2366homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2371homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2378homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2382homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2386homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2387homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2391homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2392homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2393homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2401homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2402homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2405homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2407homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2416homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2423homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2430homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2436homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2443homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2445homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2450homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2457homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2461homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2463homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2464homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2465homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2466homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2470homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2477homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2484homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2493homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2500homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2505homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2513homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2523homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2532homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2541homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2542homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2543homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2547homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2559homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2566homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2571homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2573homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2577homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2578homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2579homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2583homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2585homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2593homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2603homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2605homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2612homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2613homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2614homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2615homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2625homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2626homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2628homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2629homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2632homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2633homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2636homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2637homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2640homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2643homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2646homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2647homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2650homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2659homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2662homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2665homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2667homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2668homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2671homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2674homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2676homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2682homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2685homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2686homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2697homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2698homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2699homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2705homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2706homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2707homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2708homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2710homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2711homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2715homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2721homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2723homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2725homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2731homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2736homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2737homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2738homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2740homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2745homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2746homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2750homozygotec.1521_1523del - p.(Phe508del) - Trans
    c.3080T>C - p.(Ile1027Thr) - Trans
    CF 2753homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2762homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2765homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2768homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2781homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2787homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2788homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2791homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2792homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2793homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2813homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2814homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2815homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2823homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2825homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2831homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2832homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2835homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2839homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2840homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2841homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2845homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2846homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2847homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2849homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2851homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2852homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2855homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2858homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2866homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2867homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2868homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2872homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2873homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2876homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2878homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2881homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2887homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2890homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2892homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2894homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2900homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2902homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2908homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2909homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2910homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2912homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2914homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2915homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2916homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2920homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2922homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2923homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2924homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2925homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2926homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2927homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2930homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2931homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2933homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2935homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2936homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2941homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2943homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2945homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2946homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2951homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2953homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2954homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2958homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2959homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2963homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2965homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2967homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2969homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2972homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2979homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2981homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2982homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2987homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2992homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2993homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 2997homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3006homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3015homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3017homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3025homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3028homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3030homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3033homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3036homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3039homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3040homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3041homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3050homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3052homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3059homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3065homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3067homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3068homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3069homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3074homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3075homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3080homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3081homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3087homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3090homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3091homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3093homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3095homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3096homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3102homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3105homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3106homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3110homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3111homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3112homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3114homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3117homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3121homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3128homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3129homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3130homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3133homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3136homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3139homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3146homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3147homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3151homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3155homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3157homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3158homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3159homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3162homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3166homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3170homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3172homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3173homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3174homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3175homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3176homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3178homozygotec.1521_1523del - p.(Phe508del) - Trans
    CF 3181homozygotec.1521_1523del - p.(Phe508del) - Trans
    CBAVD 8heterozygotevarying clinical consequence - Trans
    CBAVD 65heterozygotevarying clinical consequence - Trans
    CBAVD 68heterozygoteCFTR-RD-causing - Trans
    CBAVD 81heterozygotevarying clinical consequence - Trans
    CBAVD 4679heterozygotevarying clinical consequence - Trans
    CBAVD 4682heterozygoteVUS3- Undef
    CFTR-RD-causing- Undef
    CBAVD 4683heterozygoteVUS3- Undef
    CBAVD 4699heterozygoteCFTR-RD-causing - Trans
    VUS2- Undef
    CBAVD 4703heterozygoteCFTR-RD-causing - Trans
    CBAVD 4712heterozygoteCFTR-RD-causing- Undef
    CBAVD 4717heterozygoteCFTR-RD-causing - Trans
    CBAVD 4722heterozygoteVUS3- Undef
    CBAVD 413heterozygoteCFTR-RD-causing - Trans
    CBAVD 5072heterozygoteVUS3- Undef
    CBAVD 391heterozygotenon-CF - Cis
    CFTR-RD-causing - Trans
    CBAVD 393heterozygoteCFTR-RD-causing - Trans
    CBAVD 394heterozygotevarying clinical consequence - Trans
    CBAVD 397heterozygotevarying clinical consequence - Trans
    CBAVD 398heterozygotevarying clinical consequence - Trans
    CBAVD 399heterozygoteVUS1- Undef
    CBAVD 400heterozygotevarying clinical consequence - Trans
    non-CF- Undef
    CBAVD 402heterozygoteCFTR-RD-causing - Trans
    CBAVD 408heterozygoteCFTR-RD-causing - Trans
    CBAVD 409heterozygoteCFTR-RD-causing- Undef
    CBAVD 410heterozygoteCFTR-RD-causing - Trans
    CBAVD 411heterozygoteCFTR-RD-causing- Undef
    CBAVD 412heterozygotelikely CFTR-RD - Trans
    CBAVD 414heterozygoteCFTR-RD-causing - Trans
    CBAVD 420heterozygotenon-CF- Undef
    CBAVD 421heterozygoteCFTR-RD-causing - Trans
    CBAVD 422heterozygotevarying clinical consequence - Trans
    CBAVD 425heterozygotevarying clinical consequence- Undef
    CBAVD 426heterozygotevarying clinical consequence - Trans
    CBAVD 428heterozygoteCFTR-RD-causing - Trans
    CBAVD 432heterozygote
    CBAVD 434heterozygotevarying clinical consequence - Trans
    CBAVD 435heterozygoteCFTR-RD-causing - Trans
    CBAVD 436heterozygoteCFTR-RD-causing- Undef
    CBAVD 437heterozygotevarying clinical consequence - Trans
    CBAVD 438heterozygoteCFTR-RD-causing - Trans
    CBAVD 444heterozygoteCFTR-RD-causing - Trans
    CBAVD 446heterozygoteCFTR-RD-causing - Trans
    CBAVD 447heterozygoteCFTR-RD-causing- Undef
    CBAVD 450heterozygoteCFTR-RD-causing - Trans
    CBAVD 451heterozygoteVUS3 - Cis
    likely CFTR-RD - Trans
    CBAVD 452heterozygoteVUS3- Undef
    CBAVD 454heterozygoteCFTR-RD-causing - Trans
    CBAVD 456heterozygoteCFTR-RD-causing - Trans
    CBAVD 458heterozygoteCFTR-RD-causing - Trans
    CBAVD 460heterozygoteCFTR-RD-causing - Trans
    CBAVD 462heterozygoteCFTR-RD-causing- Undef
    CFTR-RD-causing- Undef
    CBAVD 463heterozygoteCFTR-RD-causing - Trans
    CBAVD 465heterozygoteCFTR-RD-causing - Trans
    VUS3 - Trans
    CBAVD 467heterozygotevarying clinical consequence- Undef
    CBAVD 468heterozygote
    CBAVD 469heterozygoteCFTR-RD-causing- Undef
    CBAVD 470heterozygotevarying clinical consequence - Trans
    CBAVD 473heterozygoteCFTR-RD-causing - Trans
    CBAVD 474heterozygotevarying clinical consequence - Trans
    CBAVD 476heterozygoteCFTR-RD-causing - Trans
    CBAVD 477heterozygotevarying clinical consequence- Undef
    CBAVD 480heterozygoteVUS3- Undef
    CBAVD 484heterozygoteCFTR-RD-causing- Undef
    CBAVD 485heterozygoteCFTR-RD-causing- Undef
    CBAVD 486heterozygoteCFTR-RD-causing - Trans
    CBAVD 490heterozygotevarying clinical consequence- Undef
    CBAVD 491heterozygotevarying clinical consequence- Undef
    CBAVD 492heterozygotevarying clinical consequence- Undef
    CBAVD 493heterozygotevarying clinical consequence - Trans
    CBAVD 494heterozygoteCFTR-RD-causing- Undef
    CBAVD 495heterozygoteVUS3 - Cis
    CFTR-RD-causing - Trans
    CBAVD 498heterozygotevarying clinical consequence - Trans
    CBAVD 499heterozygoteCFTR-RD-causing - Trans
    VUS3- Undef
    CBAVD 501heterozygoteCFTR-RD-causing - Trans
    CBAVD 505heterozygotevarying clinical consequence - Trans
    CBAVD 506heterozygoteCFTR-RD-causing- Undef
    CBAVD 514heterozygoteCFTR-RD-causing - Trans
    CBAVD 515heterozygoteCFTR-RD-causing - Trans
    CBAVD 517heterozygoteCFTR-RD-causing- Undef
    CBAVD 519heterozygotevarying clinical consequence - Trans
    CBAVD 520heterozygoteCFTR-RD-causing- Undef
    CBAVD 522heterozygoteCFTR-RD-causing - Trans
    CBAVD 525heterozygoteCFTR-RD-causing - Trans
    CBAVD 528heterozygoteCFTR-RD-causing - Trans
    CBAVD 532heterozygoteCFTR-RD-causing - Trans
    VUS3- Undef
    CBAVD 533heterozygotevarying clinical consequence - Trans
    CBAVD 535heterozygotevarying clinical consequence - Trans
    VUS3- Undef
    CBAVD 544heterozygotevarying clinical consequence- Undef
    CBAVD 548heterozygotevarying clinical consequence - Trans
    CBAVD 549heterozygoteVUS3- Undef
    CBAVD 552heterozygoteCFTR-RD-causing- Undef
    CBAVD 555heterozygoteCFTR-RD-causing- Undef
    CBAVD 556heterozygoteVUS3- Undef
    CBAVD 591heterozygoteCFTR-RD-causing - Trans
    CBAVD 599heterozygoteCFTR-RD-causing - Trans
    CBAVD 605heterozygoteCFTR-RD-causing - Trans
    CBAVD 614heterozygotevarying clinical consequence- Undef
    CBAVD 619heterozygoteCFTR-RD-causing - Trans
    VUS3- Undef
    CBAVD 632heterozygoteCFTR-RD-causing - Trans
    CBAVD 647heterozygotevarying clinical consequence- Undef
    CBAVD 658heterozygoteVUS3- Undef
    CBAVD 665heterozygoteCFTR-RD-causing - Trans
    CBAVD 674heterozygoteCFTR-RD-causing - Trans
    CBAVD 675heterozygoteCFTR-RD-causing- Undef
    CBAVD 682heterozygoteVUS3 - Trans
    CBAVD 687heterozygoteCFTR-RD-causing - Trans
    CBAVD 689heterozygoteCFTR-RD-causing - Trans
    CBAVD 698heterozygoteCFTR-RD-causing - Trans
    CBAVD 710heterozygoteCFTR-RD-causing- Undef
    CBAVD 712heterozygoteCFTR-RD-causing - Trans
    CBAVD 717heterozygoteCFTR-RD-causing - Trans
    CBAVD 721heterozygoteCFTR-RD-causing - Trans
    CBAVD 724heterozygoteCFTR-RD-causing - Trans
    CBAVD 728heterozygoteCFTR-RD-causing- Undef
    CBAVD 735heterozygoteCFTR-RD-causing - Trans
    CBAVD 736heterozygoteCFTR-RD-causing- Undef
    CBAVD 743heterozygoteCFTR-RD-causing - Trans
    CBAVD 755heterozygoteCFTR-RD-causing - Trans
    CBAVD 763heterozygoteVUS3 - Trans
    CBAVD 765heterozygotevarying clinical consequence- Undef
    CBAVD 770heterozygoteCFTR-RD-causing - Trans
    CBAVD 774heterozygoteCFTR-RD-causing - Trans
    CBAVD 786heterozygotevarying clinical consequence - Trans
    CBAVD 792heterozygoteCFTR-RD-causing - Trans
    CBAVD 810heterozygoteVUS2- Undef
    CFTR-RD-causing- Undef
    CBAVD 819heterozygoteCFTR-RD-causing - Trans
    CBAVD 825heterozygoteCFTR-RD-causing - Trans
    CBAVD 832heterozygoteCFTR-RD-causing - Trans
    CBAVD 834heterozygotevarying clinical consequence - Trans
    CBAVD 837heterozygotevarying clinical consequence - Trans
    CBAVD 838heterozygoteCFTR-RD-causing - Trans
    CBAVD 840heterozygotevarying clinical consequence - Trans
    CBAVD 849heterozygoteCFTR-RD-causing- Undef
    CBAVD 856heterozygoteCFTR-RD-causing - Trans
    CBAVD 857heterozygotevarying clinical consequence- Undef
    CBAVD 859heterozygotevarying clinical consequence - Trans
    CBAVD 861heterozygoteCFTR-RD-causing - Trans
    CBAVD 868heterozygotelikely CFTR-RD - Trans
    CBAVD 873heterozygoteCFTR-RD-causing - Trans
    CBAVD 876heterozygotelikely CFTR-RD - Trans
    CBAVD 890heterozygoteCFTR-RD-causing - Trans
    CBAVD 891heterozygoteCFTR-RD-causing - Trans
    CBAVD 893heterozygoteCFTR-RD-causing - Trans
    CBAVD 895heterozygoteCFTR-RD-causing - Trans
    CBAVD 900heterozygoteVUS3- Undef
    CBAVD 904heterozygoteCFTR-RD-causing - Trans
    CBAVD 912heterozygotevarying clinical consequence - Trans
    CBAVD 918heterozygoteCFTR-RD-causing - Trans
    CBAVD 927heterozygoteCFTR-RD-causing - Trans
    CBAVD 949heterozygoteCFTR-RD-causing- Undef
    CBAVD 961heterozygoteCFTR-RD-causing - Trans
    CBAVD 967heterozygoteCFTR-RD-causing - Trans
    CBAVD 971heterozygoteCFTR-RD-causing - Trans
    CBAVD 978heterozygotevarying clinical consequence - Trans
    CBAVD 988heterozygoteCFTR-RD-causing - Trans
    CBAVD 4828heterozygotevarying clinical consequence- Undef
    CBAVD 4830heterozygoteCFTR-RD-causing - Trans
    CBAVD 5223heterozygoteVUS3- Undef
    CBAVD 5134heterozygoteVUS3- Undef
    CBAVD 5221heterozygotevarying clinical consequence- Undef
    CBAVD 5235heterozygoteVUS3 - Trans
    CBAVD 5524heterozygoteCFTR-RD-causing- Undef
    CBAVD 5821heterozygotevarying clinical consequence- Undef
    CBAVD 6341heterozygoteVUS3- Undef
    CBAVD 6331heterozygoteCFTR-RD-causing- Undef
    CBAVD 1048heterozygoteCFTR-RD-causing - Trans
    CBAVD 1055heterozygoteCFTR-RD-causing - Trans
    CBAVD 1056heterozygotevarying clinical consequence- Undef
    CBAVD 1065heterozygoteCFTR-RD-causing - Trans
    CBAVD 1067heterozygoteCFTR-RD-causing - Trans
    CBAVD 5230heterozygoteCFTR-RD-causing- Undef
    CBAVD 5231heterozygoteCFTR-RD-causing- Undef
    CBAVD 5181heterozygoteVUS3 - Trans
    VUS3- Undef
    CBAVD 5234heterozygoteCFTR-RD-causing - Trans
    VUS3- Undef
    CBAVD 1163heterozygotevarying clinical consequence- Undef
    CBAVD 1244heterozygotelikely CFTR-RD - Trans
    CBAVD 1252heterozygoteVUS3 - Cis
    CFTR-RD-causing - Trans
    CBAVD 1263heterozygotevarying clinical consequence - Trans
    CBAVD 1264heterozygotevarying clinical consequence - Trans
    CBAVD 1267heterozygotevarying clinical consequence - Trans
    CBAVD 1268heterozygoteCFTR-RD-causing- Undef
    CBAVD 1269heterozygoteVUS3- Undef
    CBAVD 1270heterozygoteCFTR-RD-causing - Trans
    CBAVD 1272heterozygoteCFTR-RD-causing- Undef
    CBAVD 1274heterozygotevarying clinical consequence - Trans
    CBAVD 1284heterozygoteVUS3- Undef
    CBAVD 1288heterozygoteCFTR-RD-causing - Trans
    CBAVD 1291heterozygoteCFTR-RD-causing - Trans
    CBAVD 1301heterozygoteCFTR-RD-causing- Undef
    CBAVD 1314heterozygotevarying clinical consequence- Undef
    CBAVD 1316heterozygoteCFTR-RD-causing - Trans
    CBAVD 1318heterozygotevarying clinical consequence - Trans
    CBAVD 1321heterozygoteCFTR-RD-causing - Trans
    CBAVD 1322heterozygoteCFTR-RD-causing - Trans
    CBAVD 1323heterozygotelikely CFTR-RD- Undef
    CBAVD 1326heterozygoteCFTR-RD-causing - Trans
    CBAVD 1327heterozygoteVUS2 - Cis
    varying clinical consequence - Trans
    CBAVD 1333heterozygotevarying clinical consequence - Trans
    CBAVD 1336heterozygoteCFTR-RD-causing - Trans
    CBAVD 1337heterozygotelikely CFTR-RD - Trans
    CBAVD 1338heterozygote
    CBAVD 1341heterozygoteCFTR-RD-causing - Trans
    CBAVD 1342heterozygoteCFTR-RD-causing- Undef
    CBAVD 1346heterozygoteCFTR-RD-causing - Trans
    CBAVD 1347heterozygoteCFTR-RD-causing - Trans
    CBAVD 1348heterozygoteCFTR-RD-causing - Trans
    CBAVD 1349heterozygoteCFTR-RD-causing - Trans
    CBAVD 1350heterozygotevarying clinical consequence- Undef
    CBAVD 1351heterozygoteCFTR-RD-causing- Undef
    CBAVD 1357heterozygoteCFTR-RD-causing - Trans
    CBAVD 1358heterozygote
    CBAVD 1359heterozygoteCFTR-RD-causing - Trans
    CBAVD 1360heterozygote
    CBAVD 1361heterozygoteCFTR-RD-causing - Trans
    CBAVD 1362heterozygoteCFTR-RD-causing - Trans
    CBAVD 1365heterozygoteVUS3- Undef
    CBAVD 1366heterozygoteVUS3- Undef
    CBAVD 1367heterozygoteCFTR-RD-causing - Trans
    CBAVD 1369heterozygotevarying clinical consequence- Undef
    CBAVD 1372heterozygoteCFTR-RD-causing - Trans
    CBAVD 1374heterozygoteCFTR-RD-causing- Undef
    CBAVD 1375heterozygoteCFTR-RD-causing - Trans
    CBAVD 1376heterozygoteCFTR-RD-causing - Trans
    CBAVD 1377heterozygoteVUS4- Undef
    CBAVD 1379heterozygotenon-CF- Undef
    CBAVD 1380heterozygoteCFTR-RD-causing - Trans
    CBAVD 1382heterozygotevarying clinical consequence- Undef
    CBAVD 1383heterozygoteCFTR-RD-causing - Trans
    CBAVD 1385heterozygotevarying clinical consequence- Undef
    CBAVD 1389heterozygoteCFTR-RD-causing- Undef
    CBAVD 1391heterozygoteCFTR-RD-causing - Trans
    CBAVD 1395heterozygoteCFTR-RD-causing - Trans
    CBAVD 1396heterozygoteCFTR-RD-causing - Trans
    CBAVD 1397heterozygoteCFTR-RD-causing - Trans
    CBAVD 1398heterozygoteCFTR-RD-causing - Trans
    CBAVD 1399heterozygoteVUS3 - Trans
    CBAVD 1400heterozygoteCFTR-RD-causing - Trans
    CBAVD 1402heterozygoteCFTR-RD-causing - Trans
    CBAVD 1403heterozygoteCFTR-RD-causing - Trans
    CBAVD 1404heterozygotevarying clinical consequence - Trans
    CBAVD 1406heterozygoteCFTR-RD-causing- Undef
    CBAVD 1407heterozygoteCFTR-RD-causing - Trans
    CBAVD 1408heterozygoteCFTR-RD-causing - Trans
    CBAVD 1409heterozygoteVUS2- Undef
    CBAVD 1411heterozygoteCFTR-RD-causing - Trans
    CBAVD 1414heterozygoteCFTR-RD-causing - Trans
    CBAVD 1415heterozygoteCFTR-RD-causing - Trans
    CBAVD 1416heterozygoteCFTR-RD-causing - Trans
    CBAVD 1417heterozygotevarying clinical consequence - Trans
    CBAVD 1418heterozygoteCFTR-RD-causing - Trans
    CBAVD 1420heterozygoteCFTR-RD-causing - Trans
    CBAVD 1421heterozygoteCFTR-RD-causing - Trans
    non-CF- Undef
    CBAVD 1423heterozygoteVUS3- Undef
    CBAVD 1424heterozygoteCFTR-RD-causing - Trans
    CBAVD 1426heterozygotevarying clinical consequence - Trans
    CBAVD 1427heterozygotevarying clinical consequence - Trans
    CBAVD 1428heterozygoteCFTR-RD-causing - Trans
    CBAVD 1429heterozygoteCFTR-RD-causing - Trans
    CBAVD 1432heterozygoteCFTR-RD-causing- Undef
    CBAVD 1433heterozygoteCFTR-RD-causing - Trans
    CBAVD 1435heterozygoteCFTR-RD-causing - Trans
    CBAVD 1437heterozygoteCFTR-RD-causing - Trans
    CBAVD 1439heterozygoteCFTR-RD-causing - Trans
    CBAVD 1441heterozygotevarying clinical consequence - Trans
    CBAVD 1442heterozygotevarying clinical consequence- Undef
    CBAVD 1443heterozygotevarying clinical consequence - Trans
    CBAVD 1444heterozygoteCFTR-RD-causing - Trans
    CBAVD 1446heterozygoteCFTR-RD-causing - Trans
    CBAVD 1448heterozygoteCFTR-RD-causing - Trans
    CBAVD 1449heterozygoteCFTR-RD-causing - Trans
    CBAVD 1450heterozygotevarying clinical consequence - Trans
    CBAVD 1451heterozygotevarying clinical consequence- Undef
    CBAVD 1452heterozygoteCFTR-RD-causing - Trans
    CBAVD 1458heterozygoteCFTR-RD-causing - Trans
    CBAVD 1459heterozygoteCFTR-RD-causing - Trans
    CBAVD 1460heterozygotenon-CF- Undef
    CBAVD 1461heterozygoteVUS3 - Trans
    CBAVD 1463heterozygotevarying clinical consequence- Undef
    CBAVD 1465heterozygoteCFTR-RD-causing - Trans
    VUS2 - Trans
    CBAVD 1469heterozygoteVUS3 - Cis
    CFTR-RD-causing - Trans
    CBAVD 1473heterozygotelikely CFTR-RD- Undef
    CBAVD 1475heterozygoteCFTR-RD-causing - Trans
    CBAVD 1477heterozygoteCFTR-RD-causing - Trans
    CBAVD 1479heterozygotenon-CF- Undef
    CBAVD 1480heterozygoteCFTR-RD-causing - Trans
    CBAVD 1481heterozygoteCFTR-RD-causing- Undef
    CBAVD 1483heterozygoteCFTR-RD-causing - Trans
    CBAVD 1485heterozygoteCFTR-RD-causing - Trans
    CBAVD 1488heterozygoteCFTR-RD-causing- Undef
    CBAVD 1489heterozygoteCFTR-RD-causing- Undef
    CBAVD 1493heterozygoteCFTR-RD-causing - Trans
    CBAVD 1494heterozygoteCFTR-RD-causing - Trans
    CBAVD 1495heterozygoteCFTR-RD-causing- Undef
    CBAVD 1496heterozygoteCFTR-RD-causing - Trans
    CBAVD 1497heterozygotevarying clinical consequence- Undef
    CBAVD 1498heterozygoteCFTR-RD-causing - Trans
    CBAVD 1499heterozygotenon-CF- Undef
    CBAVD 1500heterozygotevarying clinical consequence- Undef
    CBAVD 1502heterozygoteCFTR-RD-causing - Trans
    CBAVD 1503heterozygoteCFTR-RD-causing - Trans
    CBAVD 1505heterozygotevarying clinical consequence - Trans
    CBAVD 1506heterozygotevarying clinical consequence - Trans
    CBAVD 1508heterozygoteCFTR-RD-causing - Trans
    CBAVD 1510heterozygoteVUS3- Undef
    CBAVD 1512heterozygoteVUS3- Undef
    CBAVD 1521heterozygotevarying clinical consequence - Trans
    CBAVD 1644heterozygoteCFTR-RD-causing- Undef
    VUS2- Undef
    CBAVD 1668heterozygotevarying clinical consequence- Undef
    CBAVD 1672heterozygotevarying clinical consequence- Undef
    CBAVD 1674heterozygotevarying clinical consequence- Undef
    CBAVD 1680heterozygotevarying clinical consequence- Undef
    CBAVD 1724heterozygoteCFTR-RD-causing- Undef
    CBAVD 1774heterozygoteCFTR-RD-causing- Undef
    CBAVD 1783heterozygotevarying clinical consequence- Undef
    CBAVD 4969heterozygoteCFTR-RD-causing- Undef
    CBAVD 4972heterozygoteCFTR-RD-causing- Undef
    CBAVD 4980heterozygoteCFTR-RD-causing- Undef
    CBAVD 4981heterozygoteCFTR-RD-causing- Undef
    CBAVD 4982heterozygoteCFTR-RD-causing- Undef
    CBAVD 1796heterozygotevarying clinical consequence- Undef
    CBAVD 1798heterozygotevarying clinical consequence- Undef
    CBAVD 1818heterozygoteCFTR-RD-causing- Undef
    CBAVD 5025heterozygoteVUS3- Undef
    CBAVD 5471heterozygoteCFTR-RD-causing - Trans
    CBAVD 5095heterozygotevarying clinical consequence- Undef
    CBAVD 1860heterozygoteCF-causing- Undef
    CBAVD 1864heterozygotevarying clinical consequence- Undef
    CBAVD 1891heterozygoteCFTR-RD-causing- Undef
    CBAVD 1893heterozygoteCFTR-RD-causing- Undef
    CBAVD 1908heterozygotevarying clinical consequence - Trans
    CBAVD 5375heterozygotevarying clinical consequence - Trans
    CBAVD 5387heterozygoteVUS3- Undef
    CBAVD 5393heterozygotevarying clinical consequence- Undef
    CBAVD 5398heterozygotevarying clinical consequence- Undef
    CBAVD 5444heterozygoteCFTR-RD-causing- Undef
    CBAVD 5451heterozygoteCFTR-RD-causing - Trans
    CBAVD 5457heterozygoteVUS3- Undef
    CBAVD 5460heterozygoteVUS2 - Cis
    VUS3 - Cis
    CFTR-RD-causing - Trans
    CBAVD 5463heterozygoteVUS3 - Trans
    CBAVD 5673heterozygoteCF-causing- Undef
    CBAVD 5704heterozygotevarying clinical consequence- Undef
    CBAVD 5882heterozygoteVUS3 - Trans
    CBAVD 5889heterozygoteCFTR-RD-causing- Undef
    CBAVD 6277heterozygoteCFTR-RD-causing- Undef
    CBAVD 6278heterozygotevarying clinical consequence- Undef
    CBAVD 6280heterozygoteCFTR-RD-causing- Undef
    CBAVD 6387heterozygotevarying clinical consequence- Undef
    CBAVD 6389heterozygoteVUS3 - Trans
    CBAVD 6398heterozygotevarying clinical consequence- Undef
    CBAVD 6401heterozygoteVUS3- Undef
    CBAVD 1930heterozygoteVUS3- Undef
    varying clinical consequence- Undef
    CBAVD 1962heterozygoteCFTR-RD-causing- Undef
    CBAVD 1967heterozygoteVUS3- Undef
    CBAVD 1969heterozygoteVUS3- Undef
    varying clinical consequence- Undef
    CBAVD 1972heterozygoteVUS3 - Trans
    CBAVD 2004heterozygoteCFTR-RD-causing- Undef
    CBAVD 2009heterozygoteCFTR-RD-causing - Trans
    CBAVD 2014heterozygotevarying clinical consequence- Undef
    CBAVD 2025heterozygoteCFTR-RD-causing- Undef
    CBAVD 2032heterozygotevarying clinical consequence- Undef
    CBAVD 2037heterozygote
    CBAVD 2039heterozygoteCFTR-RD-causing- Undef
    CBAVD 2060heterozygotevarying clinical consequence - Trans
    CBAVD 2078heterozygoteCFTR-RD-causing- Undef
    CBAVD 2101heterozygoteCFTR-RD-causing- Undef
    CBAVD 2114heterozygotevarying clinical consequence - Trans
    CBAVD 2119heterozygoteCFTR-RD-causing- Undef
    CBAVD 2120heterozygoteCFTR-RD-causing - Trans
    CBAVD 2134heterozygoteCFTR-RD-causing - Trans
    CBAVD 2141heterozygote
    CBAVD 2203heterozygotevarying clinical consequence- Undef
    CBAVD 2221heterozygoteCFTR-RD-causing- Undef
    CBAVD 2232heterozygotevarying clinical consequence - Trans
    CBAVD 2258heterozygoteCFTR-RD-causing - Trans
    CBAVD 2261heterozygoteCFTR-RD-causing- Undef
    VUS3- Undef
    CBAVD 2263heterozygoteCFTR-RD-causing- Undef
    CBAVD 2264heterozygotevarying clinical consequence- Undef
    CBAVD 2265heterozygotenon-CF- Undef
    CBAVD 2292heterozygoteCFTR-RD-causing - Trans
    CBAVD 2337heterozygoteCFTR-RD-causing - Trans
    CBAVD 2390heterozygote
    CBAVD 2398heterozygoteCFTR-RD-causing - Trans
    CBAVD 2421heterozygoteCFTR-RD-causing- Undef
    CBAVD 2449heterozygoteCFTR-RD-causing- Undef
    CBAVD 2485heterozygoteVUS3- Undef
    VUS3- Undef
    CBAVD 2512heterozygoteCFTR-RD-causing - Trans
    CBAVD 2514heterozygoteCFTR-RD-causing - Trans
    CBAVD 2516heterozygotevarying clinical consequence- Undef
    CBAVD 2525heterozygoteCFTR-RD-causing- Undef
    CBAVD 2531heterozygoteCFTR-RD-causing - Trans
    CBAVD 2551heterozygote
    CBAVD 2556heterozygotelikely CFTR-RD- Undef
    CBAVD 2562heterozygoteCFTR-RD-causing- Undef
    CBAVD 2565heterozygote
    CBAVD 4877heterozygotevarying clinical consequence - Trans
    CBAVD 2594heterozygoteCFTR-RD-causing- Undef
    VUS3- Undef
    CBAVD 4881heterozygoteVUS3- Undef
    CBAVD 4886heterozygoteVUS3- Undef
    CBAVD 4911heterozygoteCFTR-RD-causing- Undef
    CBAVD 4919heterozygoteCFTR-RD-causing- Undef
    CBAVD 4921heterozygotevarying clinical consequence - Trans
    CBAVD 4922heterozygoteCFTR-RD-causing- Undef
    CBAVD 4935heterozygotevarying clinical consequence- Undef
    CBAVD 4944heterozygotevarying clinical consequence- Undef
    CBAVD 4949heterozygotevarying clinical consequence- Undef
    CBAVD 2638heterozygoteVUS2- Undef
    CBAVD 2663heterozygotelikely CFTR-RD- Undef
    CBAVD 2664heterozygoteCFTR-RD-causing- Undef
    CBAVD 2681heterozygotenon-CF- Undef
    CBAVD 2683heterozygotevarying clinical consequence - Trans
    CBAVD 2693heterozygoteVUS3 - Cis
    CFTR-RD-causing- Undef
    CBAVD 2695heterozygoteCFTR-RD-causing - Trans
    CBAVD 2700heterozygoteCFTR-RD-causing- Undef
    CBAVD 2704heterozygote
    CBAVD 2709heterozygoteCFTR-RD-causing- Undef
    CBAVD 2714heterozygoteCFTR-RD-causing- Undef
    CBAVD 2718heterozygoteCFTR-RD-causing - Trans
    CBAVD 2734heterozygoteCFTR-RD-causing- Undef
    CBAVD 2743heterozygoteCFTR-RD-causing - Trans
    CBAVD 2756heterozygoteVUS3- Undef
    CBAVD 2757heterozygoteCFTR-RD-causing- Undef
    CBAVD 2759heterozygoteCFTR-RD-causing- Undef
    CBAVD 3063heterozygoteCFTR-RD-causing - Trans
    CBAVD 2784heterozygoteCFTR-RD-causing - Trans
    CBAVD 2794heterozygoteCFTR-RD-causing - Trans
    CBAVD 2803heterozygote
    CBAVD 2806heterozygoteVUS3- Undef
    CBAVD 2816heterozygotevarying clinical consequence - Trans
    CBAVD 2817heterozygotevarying clinical consequence- Undef
    CBAVD 2824heterozygoteVUS3- Undef
    CBAVD 5018heterozygoteCFTR-RD-causing- Undef
    CBAVD 5019heterozygoteCFTR-RD-causing - Trans
    CBAVD 2853heterozygoteVUS3 - Trans
    CBAVD 4634heterozygotelikely CFTR-RD- Undef
    CBAVD 2869heterozygoteVUS2- Undef
    CBAVD 4622heterozygotevarying clinical consequence - Trans
    CBAVD 4624heterozygoteCFTR-RD-causing - Trans
    CBAVD 4650heterozygoteCFTR-RD-causing- Undef
    CBAVD 4756heterozygoteCFTR-RD-causing - Trans
    CBAVD 4761heterozygotevarying clinical consequence- Undef
    CBAVD 4752heterozygoteVUS3- Undef
    CBAVD 4753heterozygoteCFTR-RD-causing- Undef
    CBAVD 2918heterozygoteCFTR-RD-causing - Trans
    CBAVD 4754heterozygoteCFTR-RD-causing- Undef
    CBAVD 4755heterozygotevarying clinical consequence - Trans
    CBAVD 5015heterozygoteCFTR-RD-causing- Undef
    CBAVD 2948heterozygoteCF-causing- Undef
    CBAVD 2949heterozygoteVUS3 - Cis
    CFTR-RD-causing - Trans
    CBAVD 2976heterozygotevarying clinical consequence - Trans
    CBAVD 2989heterozygoteVUS3 - Trans
    CBAVD 2991heterozygote
    CBAVD 3002heterozygotevarying clinical consequence - Trans
    CBAVD 3003heterozygotevarying clinical consequence - Trans
    CBAVD 5068heterozygotevarying clinical consequence - Trans
    CBAVD 3051heterozygote
    CBAVD 3062heterozygotevarying clinical consequence - Trans
    CBAVD 3064heterozygoteCFTR-RD-causing - Trans
    CBAVD 3100heterozygoteCFTR-RD-causing - Trans
    CBAVD 3125heterozygotevarying clinical consequence - Trans
    VUS3- Undef
    CBAVD 3160heterozygoteCFTR-RD-causing- Undef
    CBAVD 3201heterozygoteCFTR-RD-causing - Trans
    CBAVD 3208heterozygoteVUS3- Undef
    CBAVD 3241heterozygoteCFTR-RD-causing- Undef
    CBAVD 3264heterozygotevarying clinical consequence- Undef
    CBAVD 3265heterozygoteCFTR-RD-causing - Trans
    CBAVD 3266heterozygoteCFTR-RD-causing- Undef
    CBAVD 3267heterozygoteVUS3 - Trans
    CBAVD 3270heterozygotevarying clinical consequence- Undef
    CBAVD 3272heterozygoteCFTR-RD-causing - Trans
    CBAVD 3273heterozygoteCFTR-RD-causing- Undef
    CBAVD 3276heterozygoteCFTR-RD-causing - Trans
    CBAVD 3280heterozygotevarying clinical consequence- Undef
    CBAVD 3281heterozygotevarying clinical consequence- Undef
    CBAVD 3286heterozygoteCFTR-RD-causing - Trans
    CBAVD 3288heterozygoteVUS3 - Trans
    CBAVD 3290heterozygoteCFTR-RD-causing - Trans
    CBAVD 3291heterozygotevarying clinical consequence - Trans
    CBAVD 3292heterozygotevarying clinical consequence- Undef
    CBAVD 3293heterozygotevarying clinical consequence - Trans
    CBAVD 3300heterozygoteCFTR-RD-causing - Trans
    CBAVD 3301heterozygoteCFTR-RD-causing - Trans
    CBAVD 3305heterozygotelikely CFTR-RD - Trans
    CBAVD 3307heterozygoteCFTR-RD-causing - Trans
    CBAVD 3314heterozygoteCFTR-RD-causing- Undef
    CBAVD 3316heterozygoteCFTR-RD-causing- Undef
    CBAVD 3317heterozygoteCFTR-RD-causing - Trans
    CBAVD 3322heterozygotevarying clinical consequence - Trans
    CBAVD 3323heterozygotevarying clinical consequence - Trans
    CBAVD 3324heterozygoteVUS3 - Trans
    CBAVD 3325heterozygoteCFTR-RD-causing - Trans
    CBAVD 3327heterozygoteCFTR-RD-causing - Trans
    CBAVD 3329heterozygoteCFTR-RD-causing - Trans
    CBAVD 3331heterozygoteCFTR-RD-causing - Trans
    CBAVD 3335heterozygoteVUS3 - Trans
    CBAVD 3338heterozygoteCFTR-RD-causing - Trans
    CBAVD 3339heterozygotelikely CFTR-RD- Undef
    CBAVD 3344heterozygoteCFTR-RD-causing - Trans
    CBAVD 3346heterozygoteCFTR-RD-causing- Undef
    CBAVD 3351heterozygotevarying clinical consequence- Undef
    CBAVD 3352heterozygoteCFTR-RD-causing - Trans
    CBAVD 3354heterozygoteCFTR-RD-causing- Undef
    CBAVD 3360heterozygoteCFTR-RD-causing - Trans
    CBAVD 3361heterozygoteCFTR-RD-causing- Undef
    CBAVD 3362heterozygoteCFTR-RD-causing- Undef
    CBAVD 3364heterozygote
    CBAVD 3365heterozygoteCFTR-RD-causing - Trans
    CBAVD 3366heterozygoteCFTR-RD-causing- Undef
    CBAVD 3369heterozygotevarying clinical consequence - Trans
    CBAVD 3370heterozygotelikely CFTR-RD- Undef
    CBAVD 3372heterozygoteCFTR-RD-causing - Trans
    CBAVD 3375heterozygoteCFTR-RD-causing - Trans
    CBAVD 3377heterozygoteCFTR-RD-causing - Trans
    CBAVD 3382heterozygotenon-CF- Undef
    CBAVD 3387heterozygotenon-CF- Undef
    CBAVD 3388heterozygoteCFTR-RD-causing - Trans
    CBAVD 3390heterozygoteCFTR-RD-causing- Undef
    CBAVD 3391heterozygoteCFTR-RD-causing- Undef
    CBAVD 3392heterozygoteCFTR-RD-causing- Undef
    CBAVD 3394heterozygoteCFTR-RD-causing - Trans
    varying clinical consequence - Trans
    CBAVD 3395heterozygotenon-CF- Undef
    CBAVD 3396heterozygoteCFTR-RD-causing - Trans
    CBAVD 3401heterozygoteCFTR-RD-causing - Trans
    CBAVD 3415heterozygoteCFTR-RD-causing - Trans
    CBAVD 5176heterozygotevarying clinical consequence- Undef
    CBAVD 6459heterozygoteVUS3- Undef
    CBAVD 5330heterozygoteCFTR-RD-causing- Undef
    CBAVD 5173heterozygoteVUS3 - Cis
    varying clinical consequence - Trans
    CBAVD 5344heterozygoteCF-causing- Undef
    CBAVD 5346heterozygoteCFTR-RD-causing- Undef
    CBAVD 5590heterozygoteVUS3 - Trans
    CBAVD 5944heterozygoteCFTR-RD-causing- Undef
    CBAVD 5968heterozygoteCFTR-RD-causing - Trans
    CBAVD 5969heterozygoteCFTR-RD-causing - Trans
    CBAVD 6455heterozygoteVUS3- Undef
    CBAVD 6458heterozygoteVUS3- Undef
    CBAVD 5764heterozygoteVUS3- Undef
    CBAVD 5603heterozygoteCFTR-RD-causing- Undef
    CBAVD 5610heterozygoteVUS3 - Trans
    CBAVD 5943heterozygoteVUS3- Undef
    CBAVD 5946heterozygoteVUS3- Undef
    CBAVD 5947heterozygoteVUS3- Undef
    CBAVD 5594heterozygotevarying clinical consequence- Undef
    CBAVD 5565heterozygoteCFTR-RD-causing - Trans
    varying clinical consequence- Undef
    CBAVD 4223heterozygotevarying clinical consequence- Undef
    CBAVD 4238heterozygotelikely CFTR-RD- Undef
    CBAVD 4239heterozygotelikely CFTR-RD- Undef
    CBAVD 4247heterozygoteCFTR-RD-causing- Undef
    CBAVD 4248heterozygoteCFTR-RD-causing- Undef
    CBAVD 4264heterozygoteCFTR-RD-causing- Undef
    CBAVD 4279heterozygoteVUS3- Undef
    CBAVD 4310heterozygote
    CBAVD 4311heterozygotevarying clinical consequence- Undef
    CBAVD 4313heterozygoteCFTR-RD-causing - Trans
    CBAVD 6318heterozygoteVUS3- Undef
    CBAVD 6317heterozygoteVUS3- Undef
    CBAVD 6316heterozygoteCFTR-RD-causing - Cis
    CBAVD 6307heterozygotevarying clinical consequence- Undef
    CBAVD 6321heterozygoteVUS3- Undef
    CBAVD 4331heterozygoteVUS3 - Trans
    CBAVD 4414heterozygoteCFTR-RD-causing - Trans
    CBAVD 4415heterozygoteCFTR-RD-causing - Trans
    CBAVD 4416heterozygoteCFTR-RD-causing - Trans
    CBAVD 4419heterozygotevarying clinical consequence- Undef
    CBAVD 4472heterozygoteCFTR-RD-causing- Undef
    CBAVD 4503heterozygoteVUS2- Undef
    CBAVD 4524heterozygotelikely CFTR-RD- Undef
    CBAVD 4529heterozygoteVUS2- Undef
    VUS3- Undef
    CBAVD 4531heterozygote
    CBAVD 4556heterozygoteVUS3- Undef
    CBAVD 4566heterozygoteCFTR-RD-causing- Undef
    CBAVD 4571heterozygoteVUS3- Undef
    CBAVD 4575heterozygoteCFTR-RD-causing- Undef
    CBAVD 4578heterozygoteCFTR-RD-causing - Trans
    CBAVD 4584heterozygotevarying clinical consequence- Undef
    CBAVD 4598heterozygoteVUS3- Undef
    VUS2- Undef
    CBAVD 4612heterozygoteVUS3- Undef
    CBAVD 5063heterozygotenon-CF- Undef
    CBAVD 6466heterozygotevarying clinical consequence- Undef
    CBAVD 6463heterozygotevarying clinical consequence- Undef
    CBAVD 6465heterozygoteCFTR-RD-causing- Undef
    CBAVD 6471heterozygoteVUS3- Undef
    CBAVD 6479heterozygotevarying clinical consequence - Trans
    CBAVD 5995heterozygoteCF-causing - Trans
    Bronchiectasis 4678heterozygotevarying clinical consequence - Trans
    Bronchiectasis 4725heterozygoteCFTR-RD-causing- Undef
    Bronchiectasis 4734heterozygotevarying clinical consequence- Undef
    Bronchiectasis 4833heterozygoteCFTR-RD-causing- Undef
    Bronchiectasis 560heterozygoteCFTR-RD-causing- Undef
    Bronchiectasis 850heterozygotevarying clinical consequence - Trans
    Bronchiectasis 879heterozygoteCFTR-RD-causing- Undef
    Bronchiectasis 899heterozygote
    Bronchiectasis 921heterozygoteVUS3 - Trans
    Bronchiectasis 962heterozygoteVUS2 - Trans
    varying clinical consequence - Trans
    Bronchiectasis 5137heterozygotevarying clinical consequence- Undef
    Bronchiectasis 5824heterozygotevarying clinical consequence- Undef
    Bronchiectasis 5826heterozygotevarying clinical consequence- Undef
    Bronchiectasis 6350heterozygotevarying clinical consequence- Undef
    Bronchiectasis 6330heterozygotevarying clinical consequence- Undef
    Bronchiectasis 6344heterozygotevarying clinical consequence- Undef
    Bronchiectasis 4773heterozygoteCFTR-RD-causing - Trans
    VUS3- Undef
    Bronchiectasis 1068heterozygotelikely CFTR-RD - Trans
    Bronchiectasis 5200heterozygotenon-CF - Trans
    VUS3- Undef
    Bronchiectasis 5182heterozygotevarying clinical consequence- Undef
    VUS3- Undef
    Bronchiectasis 1078heterozygotevarying clinical consequence- Undef
    Bronchiectasis 1088heterozygotevarying clinical consequence - Trans
    Bronchiectasis 1090heterozygoteVUS3 - Cis
    varying clinical consequence - Trans
    Bronchiectasis 1096heterozygotevarying clinical consequence- Undef
    Bronchiectasis 1117heterozygotevarying clinical consequence- Undef
    Bronchiectasis 1197heterozygote
    Bronchiectasis 4848heterozygotevarying clinical consequence - Trans
    Bronchiectasis 4863heterozygotevarying clinical consequence- Undef
    Bronchiectasis 4857heterozygoteCF-causing - Trans
    Bronchiectasis 5849heterozygotevarying clinical consequence - Trans
    Bronchiectasis 1542heterozygoteCFTR-RD-causing - Trans
    Bronchiectasis 1631heterozygotevarying clinical consequence- Undef
    Bronchiectasis 1752heterozygote
    Bronchiectasis 4984heterozygote
    Bronchiectasis 5000heterozygoteCFTR-RD-causing - Trans
    Bronchiectasis 5043heterozygote
    Bronchiectasis 1829heterozygoteCFTR-RD-causing- Undef
    Bronchiectasis 1844heterozygote
    Bronchiectasis 5103heterozygote
    Bronchiectasis 5111heterozygoteCFTR-RD-causing- Undef
    Bronchiectasis 1866heterozygote
    Bronchiectasis 1902heterozygotevarying clinical consequence- Undef
    Bronchiectasis 1905heterozygotelikely CFTR-RD- Undef
    Bronchiectasis 5706heterozygoteVUS3- Undef
    Bronchiectasis 5873heterozygote
    Bronchiectasis 5887heterozygotevarying clinical consequence- Undef
    Bronchiectasis 6244heterozygotevarying clinical consequence - Trans
    Bronchiectasis 6228heterozygotelikely CFTR-RD - Trans
    Bronchiectasis 6273heterozygotevarying clinical consequence - Trans
    Bronchiectasis 6393heterozygotevarying clinical consequence- Undef
    Bronchiectasis 6399heterozygotevarying clinical consequence- Undef
    Bronchiectasis 2055heterozygotevarying clinical consequence- Undef
    Bronchiectasis 2118heterozygotevarying clinical consequence- Undef
    Bronchiectasis 2139heterozygoteCFTR-RD-causing- Undef
    Bronchiectasis 2243heterozygote
    Bronchiectasis 2254heterozygotevarying clinical consequence- Undef
    Bronchiectasis 2287heterozygoteCFTR-RD-causing- Undef
    Bronchiectasis 2304heterozygote
    Bronchiectasis 2307heterozygote
    Bronchiectasis 2356heterozygoteVUS3 - Cis
    Bronchiectasis 2358heterozygote
    Bronchiectasis 2368heterozygoteCFTR-RD-causing - Trans
    Bronchiectasis 2409heterozygoteVUS3- Undef
    Bronchiectasis 2415heterozygote
    Bronchiectasis 2420heterozygote
    Bronchiectasis 2440heterozygote
    Bronchiectasis 2453heterozygote
    Bronchiectasis 2454heterozygote
    Bronchiectasis 2492heterozygote
    Bronchiectasis 2522heterozygoteVUS3- Undef
    Bronchiectasis 2526heterozygote
    Bronchiectasis 2539heterozygote
    Bronchiectasis 2590heterozygote
    Bronchiectasis 4947heterozygoteCFTR-RD-causing- Undef
    Bronchiectasis 2677heterozygotevarying clinical consequence- Undef
    Bronchiectasis 3269heterozygote
    Bronchiectasis 4623heterozygotevarying clinical consequence- Undef
    Bronchiectasis 4657heterozygotevarying clinical consequence- Undef
    Bronchiectasis 5005heterozygoteCFTR-RD-causing- Undef
    Bronchiectasis 5170heterozygotevarying clinical consequence - Trans
    Bronchiectasis 5950heterozygoteVUS3- Undef
    Bronchiectasis 5952heterozygoteCFTR-RD-causing - Trans
    Bronchiectasis 5564heterozygotenon-CF - Cis
    CFTR-RD-causing - Trans
    Bronchiectasis 3698heterozygoteCFTR-RD-causing- Undef
    Bronchiectasis 4295heterozygote
    Bronchiectasis 4314heterozygote
    Bronchiectasis 4321heterozygotevarying clinical consequence- Undef
    Bronchiectasis 4421heterozygotevarying clinical consequence - Trans
    Bronchiectasis 4604heterozygotevarying clinical consequence- Undef
    Bronchiectasis 4607heterozygotevarying clinical consequence- Undef
    Bronchiectasis 4608heterozygotelikely CFTR-RD - Trans
    Bronchiectasis 6200heterozygote
    Bronchiectasis 6167heterozygoteCF-causing - Trans
    Bronchiectasis 5283heterozygotevarying clinical consequence - Trans
    Bronchiectasis 6115heterozygoteCF-causing- Undef
    Pancreatitis 76heterozygoteCFTR-RD-causing - Trans
    Pancreatitis 80heterozygoteCFTR-RD-causing - Trans
    Pancreatitis 4721heterozygotevarying clinical consequence- Undef
    Pancreatitis 205heterozygoteCFTR-RD-causing - Trans
    Pancreatitis 669heterozygote
    Pancreatitis 776heterozygotevarying clinical consequence - Trans
    Pancreatitis 5145heterozygoteCFTR-RD-causing- Undef
    Pancreatitis 5142heterozygoteCFTR-RD-causing- Undef
    Pancreatitis 4789heterozygotevarying clinical consequence- Undef
    Pancreatitis 1063heterozygotevarying clinical consequence - Trans
    Pancreatitis 1161heterozygoteVUS3 - Cis
    Pancreatitis 1597heterozygotevarying clinical consequence- Undef
    Pancreatitis 1632heterozygote
    Pancreatitis 1669heterozygoteVUS1- Undef
    Pancreatitis 1703heterozygotevarying clinical consequence- Undef
    Pancreatitis 1712heterozygotevarying clinical consequence- Undef
    Pancreatitis 1735heterozygoteCFTR-RD-causing - Trans
    Pancreatitis 5029heterozygotenon-CF- Undef
    Pancreatitis 1832heterozygotevarying clinical consequence- Undef
    Pancreatitis 1836heterozygoteCFTR-RD-causing- Undef
    Pancreatitis 5108heterozygote
    Pancreatitis 1862heterozygotevarying clinical consequence- Undef
    Pancreatitis 5452heterozygotevarying clinical consequence- Undef
    Pancreatitis 5453heterozygoteCFTR-RD-causing- Undef
    Pancreatitis 5454heterozygoteCFTR-RD-causing- Undef
    Pancreatitis 5739heterozygote
    Pancreatitis 5741heterozygote
    Pancreatitis 5877heterozygote
    Pancreatitis 5892heterozygoteCFTR-RD-causing- Undef
    Pancreatitis 6270heterozygotevarying clinical consequence- Undef
    Pancreatitis 6550heterozygoteCFTR-RD-causing- Undef
    VUS3- Undef
    Pancreatitis 1980heterozygotevarying clinical consequence- Undef
    Pancreatitis 1981heterozygoteVUS3- Undef
    Pancreatitis 2000heterozygotevarying clinical consequence- Undef
    Pancreatitis 2067heterozygotevarying clinical consequence- Undef
    Pancreatitis 2091heterozygoteCFTR-RD-causing- Undef
    Pancreatitis 2204heterozygotenon-CF- Undef
    Pancreatitis 2252heterozygote
    Pancreatitis 2314heterozygote
    Pancreatitis 2473heterozygoteCFTR-RD-causing- Undef
    Pancreatitis 2476heterozygote
    Pancreatitis 2490heterozygoteVUS3- Undef
    Pancreatitis 2511heterozygote
    Pancreatitis 4876heterozygotelikely CFTR-RD - Trans
    Pancreatitis 4907heterozygoteCFTR-RD-causing- Undef
    Pancreatitis 2617heterozygotevarying clinical consequence- Undef
    Pancreatitis 2623heterozygotevarying clinical consequence- Undef
    Pancreatitis 5179heterozygoteCFTR-RD-causing- Undef
    Pancreatitis 2786heterozygoteCFTR-RD-causing - Trans
    Pancreatitis 2860heterozygotelikely CFTR-RD - Trans
    Pancreatitis 3024heterozygoteCFTR-RD-causing - Trans
    Pancreatitis 4635heterozygotelikely CFTR-RD- Undef
    Pancreatitis 3253heterozygoteCFTR-RD-causing- Undef
    Pancreatitis 4636heterozygotenon-CF - Trans
    Pancreatitis 4743heterozygoteCFTR-RD-causing- Undef
    Pancreatitis 5007heterozygoteVUS3- Undef
    Pancreatitis 5326heterozygoteCFTR-RD-causing - Trans
    varying clinical consequence - Trans
    Pancreatitis 5949heterozygotevarying clinical consequence - Trans
    Pancreatitis 5569heterozygoteCFTR-RD-causing - Trans
    Pancreatitis 5160heterozygotevarying clinical consequence - Trans
    VUS3- Undef
    Pancreatitis 4226heterozygoteVUS3- Undef
    Pancreatitis 4240heterozygoteVUS3 - Cis
    Pancreatitis 4241heterozygotevarying clinical consequence- Undef
    Pancreatitis 4261heterozygotelikely CFTR-RD- Undef
    Pancreatitis 4270heterozygotevarying clinical consequence - Trans
    Pancreatitis 4299heterozygotevarying clinical consequence- Undef
    Pancreatitis 4815heterozygoteCF-causing - Trans
    Pancreatitis 4559heterozygoteVUS3 - Trans
    Pancreatitis 4581heterozygoteCFTR-RD-causing- Undef
    Pancreatitis 6199heterozygoteCFTR-RD-causing - Trans
    Pancreatitis 6198heterozygoteCFTR-RD-causing - Trans
    Pancreatitis 6183heterozygoteCFTR-RD-causing - Trans
    varying clinical consequence - Trans
    CRS-NP 5531heterozygoteCFTR-RD-causing - Trans
    VUS3 - Trans
    CRS-NP 1220heterozygoteCF-causing- Undef
    CRS-NP 1239heterozygote
    CRS-NP 5762heterozygoteVUS3 - Trans
    CRS-NP 5761heterozygoteVUS3 - Trans
    CRS-NP 6553heterozygoteVUS3- Undef
    CRS-NP 6279heterozygotevarying clinical consequence - Trans
    CRS-NP 2189heterozygoteCFTR-RD-causing- Undef
    CRS-NP 2917heterozygoteCFTR-RD-causing - Trans
    CRS-NP 3043heterozygoteVUS3 - Trans
    CRS-NP 3088heterozygoteCFTR-RD-causing - Trans
    CRS-NP 4649heterozygotevarying clinical consequence - Trans
    CRS-NP 3161heterozygotevarying clinical consequence - Trans
    VUS3- Undef
    CRS-NP 6308heterozygotevarying clinical consequence- Undef
    CRS-NP 4319heterozygoteCFTR-RD-causing - Trans
    CRS-NP 6313heterozygoteCFTR-RD-causing - Trans
    varying clinical consequence - Trans
    CRS-NP 4513heterozygotevarying clinical consequence - Trans
    CRS-NP 6196heterozygotevarying clinical consequence- Undef
    CRS-NP 5994heterozygoteCFTR-RD-causing - Trans
    CRS-NP 6189heterozygotevarying clinical consequence- Undef
    Asymptomatic compound heterozygote 4685heterozygote
    Asymptomatic compound heterozygote 4839heterozygoteVUS2 - Trans
    Asymptomatic compound heterozygote 370heterozygoteVUS2 - Trans
    Asymptomatic compound heterozygote 459heterozygoteCFTR-RD-causing - Trans
    Asymptomatic compound heterozygote 496heterozygoteVUS3 - Cis
    CFTR-RD-causing - Trans
    Asymptomatic compound heterozygote 542heterozygotevarying clinical consequence - Trans
    Asymptomatic compound heterozygote 766heterozygote
    Asymptomatic compound heterozygote 768heterozygoteCFTR-RD-causing - Trans
    Asymptomatic compound heterozygote 778heterozygoteCFTR-RD-causing - Trans
    Asymptomatic compound heterozygote 796heterozygotenon-CF - Cis
    CFTR-RD-causing - Trans
    Asymptomatic compound heterozygote 925heterozygoteCFTR-RD-causing - Trans
    Asymptomatic compound heterozygote 932heterozygoteCFTR-RD-causing - Trans
    Asymptomatic compound heterozygote 958heterozygoteCFTR-RD-causing - Trans
    Asymptomatic compound heterozygote 4829heterozygoteVUS2- Undef
    Asymptomatic compound heterozygote 5140heterozygoteVUS3 - Trans
    Asymptomatic compound heterozygote 5279heterozygoteVUS3 - Trans
    Asymptomatic compound heterozygote 5942heterozygoteCFTR-RD-causing - Trans
    Asymptomatic compound heterozygote 6556heterozygoteVUS3 - Trans
    Asymptomatic compound heterozygote 5513heterozygoteCFTR-RD-causing - Trans
    Asymptomatic compound heterozygote 5233heterozygoteCFTR-RD-causing - Trans
    Asymptomatic compound heterozygote 1529heterozygotevarying clinical consequence- Undef
    Asymptomatic compound heterozygote 1574heterozygotevarying clinical consequence - Trans
    Asymptomatic compound heterozygote 5027heterozygoteVUS3- Undef
    Asymptomatic compound heterozygote 5376heterozygotevarying clinical consequence - Trans
    Asymptomatic compound heterozygote 5695heterozygote
    Asymptomatic compound heterozygote 6251heterozygoteVUS3 - Trans
    Asymptomatic compound heterozygote 1935heterozygote
    Asymptomatic compound heterozygote 2142heterozygote
    Asymptomatic compound heterozygote 2159heterozygoteCFTR-RD-causing- Undef
    Asymptomatic compound heterozygote 2225heterozygoteCFTR-RD-causing- Undef
    Asymptomatic compound heterozygote 2777heterozygote
    Asymptomatic compound heterozygote 2819heterozygoteVUS2 - Trans
    Asymptomatic compound heterozygote 2929heterozygote
    Asymptomatic compound heterozygote 2956heterozygote
    Asymptomatic compound heterozygote 2971heterozygotevarying clinical consequence - Trans
    Asymptomatic compound heterozygote 2980heterozygotevarying clinical consequence - Trans
    Asymptomatic compound heterozygote 3013heterozygoteCFTR-RD-causing - Trans
    Asymptomatic compound heterozygote 3019heterozygoteCFTR-RD-causing - Trans
    Asymptomatic compound heterozygote 3031heterozygotevarying clinical consequence - Trans
    Asymptomatic compound heterozygote 3032heterozygote
    Asymptomatic compound heterozygote 4757heterozygote
    Asymptomatic compound heterozygote 4758heterozygote
    Asymptomatic compound heterozygote 3191heterozygoteCFTR-RD-causing - Trans
    Asymptomatic compound heterozygote 3204heterozygoteCFTR-RD-causing - Trans
    Asymptomatic compound heterozygote 3206heterozygoteVUS3 - Trans
    Asymptomatic compound heterozygote 3238heterozygoteVUS2- Undef
    Asymptomatic compound heterozygote 3257heterozygoteVUS3 - Trans
    Asymptomatic compound heterozygote 4617heterozygoteVUS3 - Trans
    Asymptomatic compound heterozygote 4641heterozygote
    Asymptomatic compound heterozygote 4763heterozygote
    Asymptomatic compound heterozygote 4749heterozygoteCFTR-RD-causing - Trans
    Asymptomatic compound heterozygote 4742heterozygoteCFTR-RD-causing - Trans
    Asymptomatic compound heterozygote 5004heterozygote
    Asymptomatic compound heterozygote 5976heterozygoteVUS3 - Trans
    Asymptomatic compound heterozygote 6440heterozygotevarying clinical consequence - Trans
    Asymptomatic compound heterozygote 6452heterozygoteCFTR-RD-causing - Trans
    Asymptomatic compound heterozygote 5166heterozygotevarying clinical consequence - Trans
    Asymptomatic compound heterozygote 5306heterozygoteCFTR-RD-causing - Trans
    Asymptomatic compound heterozygote 5596heterozygoteCFTR-RD-causing- Undef
    Asymptomatic compound heterozygote 5598heterozygotenon-CF - Trans
    Asymptomatic compound heterozygote 5599heterozygote
    Asymptomatic compound heterozygote 5601heterozygote
    Asymptomatic compound heterozygote 5597heterozygotenon-CF - Trans
    Asymptomatic compound heterozygote 5964heterozygoteVUS3 - Trans
    Asymptomatic compound heterozygote 5776heterozygoteVUS3 - Trans
    Asymptomatic compound heterozygote 5309heterozygote
    Asymptomatic compound heterozygote 5164heterozygote
    Asymptomatic compound heterozygote 5760heterozygote
    Asymptomatic compound heterozygote 4235heterozygotevarying clinical consequence- Undef
    Asymptomatic compound heterozygote 4375heterozygoteVUS2 - Trans
    Asymptomatic compound heterozygote 4411heterozygoteVUS3 - Trans
    Asymptomatic compound heterozygote 4564heterozygotevarying clinical consequence - Trans
    Asymptomatic compound heterozygote 5240heterozygoteCFTR-RD-causing - Trans
    Pending 4680heterozygotevarying clinical consequence - Trans
    Pending 5216heterozygoteCFTR-RD-causing- Undef
    Pending 6548heterozygotevarying clinical consequence- Undef
    Pending 1091heterozygotevarying clinical consequence - Trans
    Pending 1181heterozygoteCFTR-RD-causing - Trans
    Pending 1212heterozygotevarying clinical consequence - Trans
    Pending 1586heterozygotevarying clinical consequence - Trans
    Pending 1635heterozygoteVUS3- Undef
    Pending 1786heterozygoteVUS3- Undef
    Pending 1990heterozygoteCFTR-RD-causing- Undef
    Pending 2174heterozygotevarying clinical consequence - Trans
    Pending 2273heterozygoteCFTR-RD-causing - Trans
    Pending 2428heterozygoteCFTR-RD-causing- Undef
    Pending 4945heterozygotevarying clinical consequence - Trans
    Pending 2833heterozygoteVUS3 - Trans
    Pending 2843heterozygoteVUS3 - Trans
    Pending 2944heterozygotevarying clinical consequence - Trans
    Pending 4640heterozygote
    Pending 3236heterozygote
    Pending 4748heterozygoteCFTR-RD-causing - Trans
    Pending 5771heterozygoteCF-causing - Trans
    Pending 5568heterozygoteCF-causing - Trans
    Pending 3574heterozygotevarying clinical consequence - Trans
    Pending 4078heterozygote
    Pending 4215heterozygote
    Pending 4229heterozygoteCFTR-RD-causing - Trans
    Pending 4336heterozygote
    Pending 4337heterozygoteVUS3 - Trans
    Pending 4548heterozygote
    Pending 4590heterozygoteVUS3 - Trans
    Pending (NBS) 4694heterozygote
    Pending (NBS) 4667heterozygoteCFTR-RD-causing - Trans
    Pending (NBS) 4720heterozygoteCFTR-RD-causing - Trans
    Pending (NBS) 5514heterozygoteVUS3 - Trans
    Pending (NBS) 352heterozygoteCFTR-RD-causing - Trans
    Pending (NBS) 377heterozygotevarying clinical consequence - Trans
    Pending (NBS) 387heterozygoteVUS3- Undef
    Pending (NBS) 590heterozygotevarying clinical consequence - Trans
    Pending (NBS) 598heterozygote
    Pending (NBS) 644heterozygoteCFTR-RD-causing - Trans
    Pending (NBS) 646heterozygotevarying clinical consequence - Trans
    Pending (NBS) 726heterozygotevarying clinical consequence - Trans
    Pending (NBS) 734heterozygotevarying clinical consequence - Trans
    Pending (NBS) 748heterozygotevarying clinical consequence - Trans
    Pending (NBS) 775heterozygote
    Pending (NBS) 785heterozygoteCFTR-RD-causing - Trans
    Pending (NBS) 794heterozygotevarying clinical consequence - Trans
    Pending (NBS) 826heterozygoteCFTR-RD-causing - Trans
    Pending (NBS) 944heterozygoteCFTR-RD-causing - Trans
    Pending (NBS) 5748heterozygotenon-CF- Undef
    Pending (NBS) 6346heterozygotevarying clinical consequence - Trans
    Pending (NBS) 5520heterozygoteVUS3 - Trans
    Pending (NBS) 5254heterozygoteCFTR-RD-causing - Trans
    Pending (NBS) 5247heterozygoteVUS1 - Cis
    CFTR-RD-causing - Trans
    VUS3 - Trans
    Pending (NBS) 5816heterozygoteCFTR-RD-causing- Undef
    Pending (NBS) 5808heterozygoteVUS3 - Trans
    Pending (NBS) 5817heterozygoteCFTR-RD-causing- Undef
    Pending (NBS) 6337heterozygotevarying clinical consequence- Undef
    Pending (NBS) 5088heterozygotevarying clinical consequence- Undef
    Pending (NBS) 5219heterozygotenon-CF - Trans
    Pending (NBS) 5280heterozygotevarying clinical consequence - Trans
    Pending (NBS) 5852heterozygotevarying clinical consequence - Trans
    Pending (NBS) 5805heterozygotevarying clinical consequence - Trans
    Pending (NBS) 5803heterozygotevarying clinical consequence - Trans
    VUS3 - Trans
    Pending (NBS) 4769heterozygotevarying clinical consequence- Undef
    Pending (NBS) 4787heterozygotevarying clinical consequence - Trans
    VUS3- Undef
    Pending (NBS) 5183heterozygoteCFTR-RD-causing - Trans
    VUS3- Undef
    Pending (NBS) 1070heterozygotevarying clinical consequence - Trans
    Pending (NBS) 5190heterozygoteVUS3- Undef
    VUS3- Undef
    varying clinical consequence- Undef
    Pending (NBS) 1076heterozygotevarying clinical consequence - Trans
    Pending (NBS) 1077heterozygoteCFTR-RD-causing - Trans
    Pending (NBS) 5202heterozygoteCFTR-RD-causing- Undef
    VUS3- Undef
    Pending (NBS) 1087heterozygotevarying clinical consequence - Trans
    Pending (NBS) 1180heterozygotevarying clinical consequence - Trans
    Pending (NBS) 1253heterozygoteCFTR-RD-causing - Trans
    VUS3- Undef
    Pending (NBS) 1312heterozygoteVUS3- Undef
    Pending (NBS) 4852heterozygoteVUS3 - Trans
    Pending (NBS) 6215heterozygotevarying clinical consequence - Trans
    Pending (NBS) 6216heterozygoteCFTR-RD-causing - Trans
    non-CF - Trans
    Pending (NBS) 1513heterozygoteCFTR-RD-causing - Trans
    Pending (NBS) 1514heterozygoteCFTR-RD-causing - Trans
    Pending (NBS) 1522heterozygotenon-CF - Trans
    Pending (NBS) 1530heterozygoteVUS4 - Trans
    Pending (NBS) 1547heterozygotevarying clinical consequence - Trans
    Pending (NBS) 1563heterozygoteVUS3 - Trans
    Pending (NBS) 1566heterozygotevarying clinical consequence - Trans
    Pending (NBS) 1575heterozygotevarying clinical consequence- Undef
    Pending (NBS) 1580heterozygotevarying clinical consequence - Trans
    Pending (NBS) 5037heterozygoteCFTR-RD-causing- Undef
    varying clinical consequence- Undef
    Pending (NBS) 5039heterozygotevarying clinical consequence- Undef
    Pending (NBS) 5445heterozygotelikely CFTR-RD- Undef
    Pending (NBS) 5446heterozygoteVUS3 - Trans
    Pending (NBS) 5450heterozygotevarying clinical consequence - Trans
    Pending (NBS) 6397heterozygotevarying clinical consequence- Undef
    Pending (NBS) 2038heterozygoteCFTR-RD-causing- Undef
    Pending (NBS) 2520heterozygote
    Pending (NBS) 4951heterozygoteCFTR-RD-causing - Trans
    Pending (NBS) 6283heterozygoteVUS3 - Trans
    Pending (NBS) 5399heterozygotevarying clinical consequence- Undef
    Pending (NBS) 2727heterozygotevarying clinical consequence - Trans
    Pending (NBS) 2875heterozygotevarying clinical consequence - Trans
    Pending (NBS) 2895heterozygotevarying clinical consequence - Trans
    Pending (NBS) 2905heterozygotevarying clinical consequence - Trans
    Pending (NBS) 2964heterozygotevarying clinical consequence - Trans
    Pending (NBS) 2970heterozygotevarying clinical consequence - Trans
    Pending (NBS) 3011heterozygoteCFTR-RD-causing - Trans
    Pending (NBS) 3118heterozygotevarying clinical consequence- Undef
    Pending (NBS) 4638heterozygoteCFTR-RD-causing - Trans
    Pending (NBS) 5017heterozygoteCFTR-RD-causing - Trans
    Pending (NBS) 4666heterozygoteCFTR-RD-causing - Trans
    Pending (NBS) 4643heterozygoteCFTR-RD-causing - Trans
    Pending (NBS) 4616heterozygoteCFTR-RD-causing - Trans
    Pending (NBS) 4620heterozygotevarying clinical consequence- Undef
    Pending (NBS) 4621heterozygoteCFTR-RD-causing - Trans
    Pending (NBS) 5020heterozygoteVUS3 - Trans
    Pending (NBS) 5012heterozygotelikely CFTR-RD - Trans
    Pending (NBS) 4654heterozygotevarying clinical consequence - Trans
    Pending (NBS) 5312heterozygote
    Pending (NBS) 5361heterozygoteVUS3 - Trans
    Pending (NBS) 5305heterozygoteCFTR-RD-causing - Trans
    Pending (NBS) 6457heterozygotevarying clinical consequence- Undef
    Pending (NBS) 5313heterozygoteVUS3 - Trans
    Pending (NBS) 5310heterozygoteCF-causing- Undef
    VUS3- Undef
    Pending (NBS) 5327heterozygotevarying clinical consequence - Trans
    Pending (NBS) 5566heterozygoteCFTR-RD-causing - Trans
    Pending (NBS) 5342heterozygotevarying clinical consequence - Trans
    Pending (NBS) 5769heterozygotevarying clinical consequence - Trans
    VUS3- Undef
    Pending (NBS) 5773heterozygoteVUS3 - Cis
    VUS3 - Trans
    Pending (NBS) 5951heterozygotevarying clinical consequence - Trans
    Pending (NBS) 5572heterozygoteCFTR-RD-causing - Trans
    Pending (NBS) 5573heterozygoteCFTR-RD-causing - Trans
    Pending (NBS) 3437heterozygoteCFTR-RD-causing - Trans
    Pending (NBS) 3438heterozygoteCFTR-RD-causing - Trans
    Pending (NBS) 3442heterozygoteCFTR-RD-causing- Undef
    Pending (NBS) 3453heterozygotevarying clinical consequence- Undef
    Pending (NBS) 3458heterozygoteCFTR-RD-causing - Trans
    Pending (NBS) 3465heterozygotevarying clinical consequence- Undef
    Pending (NBS) 3472heterozygoteCFTR-RD-causing- Undef
    Pending (NBS) 3477heterozygoteCFTR-RD-causing- Undef
    Pending (NBS) 3492heterozygotevarying clinical consequence- Undef
    Pending (NBS) 3504heterozygoteCFTR-RD-causing- Undef
    Pending (NBS) 3512heterozygoteCFTR-RD-causing- Undef
    Pending (NBS) 3540heterozygoteCFTR-RD-causing - Trans
    Pending (NBS) 3548heterozygotevarying clinical consequence- Undef
    Pending (NBS) 5118heterozygotevarying clinical consequence- Undef
    Pending (NBS) 5788heterozygoteVUS3 - Trans
    Pending (NBS) 5781heterozygoteVUS3 - Trans
    Pending (NBS) 3579heterozygoteCFTR-RD-causing- Undef
    Pending (NBS) 3590heterozygoteCFTR-RD-causing- Undef
    Pending (NBS) 5241heterozygoteCFTR-RD-causing - Trans
    Pending (NBS) 5117heterozygotevarying clinical consequence- Undef
    Pending (NBS) 3628heterozygotevarying clinical consequence- Undef
    Pending (NBS) 3648heterozygoteCFTR-RD-causing - Trans
    Pending (NBS) 3658heterozygotevarying clinical consequence - Trans
    Pending (NBS) 3668heterozygoteCFTR-RD-causing - Trans
    Pending (NBS) 3672heterozygoteCFTR-RD-causing - Trans
    Pending (NBS) 5801heterozygotelikely CFTR-RD - Trans
    Pending (NBS) 3707heterozygotevarying clinical consequence- Undef
    Pending (NBS) 3713heterozygotevarying clinical consequence - Trans
    Pending (NBS) 3724heterozygotevarying clinical consequence- Undef
    Pending (NBS) 5802heterozygoteVUS3 - Trans
    Pending (NBS) 3763heterozygotevarying clinical consequence - Trans
    Pending (NBS) 3773heterozygoteCFTR-RD-causing- Undef
    Pending (NBS) 3775heterozygoteCFTR-RD-causing - Trans
    Pending (NBS) 3787heterozygoteCFTR-RD-causing - Trans
    Pending (NBS) 3842heterozygotevarying clinical consequence- Undef
    Pending (NBS) 3876heterozygotevarying clinical consequence- Undef
    Pending (NBS) 3884heterozygotevarying clinical consequence - Trans
    Pending (NBS) 3905heterozygoteCFTR-RD-causing- Undef
    Pending (NBS) 3908heterozygotevarying clinical consequence- Undef
    Pending (NBS) 3909heterozygoteCFTR-RD-causing- Undef
    Pending (NBS) 3980heterozygote
    Pending (NBS) 3982heterozygoteCFTR-RD-causing- Undef
    Pending (NBS) 4010heterozygoteCFTR-RD-causing - Trans
    Pending (NBS) 4014heterozygotevarying clinical consequence- Undef
    Pending (NBS) 4019heterozygoteCFTR-RD-causing- Undef
    Pending (NBS) 5786heterozygotelikely CF - Trans
    Pending (NBS) 4119heterozygoteCFTR-RD-causing - Trans
    Pending (NBS) 4122heterozygoteCFTR-RD-causing- Undef
    Pending (NBS) 4137heterozygotevarying clinical consequence - Trans
    Pending (NBS) 4145heterozygotevarying clinical consequence- Undef
    Pending (NBS) 4146heterozygoteCFTR-RD-causing- Undef
    Pending (NBS) 4159heterozygoteCFTR-RD-causing - Trans
    Pending (NBS) 4174heterozygotevarying clinical consequence - Trans
    Pending (NBS) 4182heterozygoteCFTR-RD-causing - Trans
    Pending (NBS) 4202heterozygotevarying clinical consequence- Undef
    Pending (NBS) 4228heterozygotevarying clinical consequence - Trans
    Pending (NBS) 4249heterozygote
    Pending (NBS) 4263heterozygoteCFTR-RD-causing - Trans
    Pending (NBS) 4266heterozygotevarying clinical consequence- Undef
    Pending (NBS) 4286heterozygoteVUS2 - Trans
    Pending (NBS) 4288heterozygotevarying clinical consequence - Trans
    Pending (NBS) 4320heterozygoteCFTR-RD-causing - Trans
    Pending (NBS) 4407heterozygotevarying clinical consequence - Trans
    Pending (NBS) 4409heterozygoteCFTR-RD-causing - Trans
    non-CF - Trans
    Pending (NBS) 4508heterozygotevarying clinical consequence - Trans
    Pending (NBS) 4549heterozygoteVUS3 - Cis
    Pending (NBS) 4573heterozygote
    Pending (NBS) 4593heterozygoteVUS3 - Trans
    Pending (NBS) 6039heterozygotevarying clinical consequence- Undef
    Pending (NBS) 6081heterozygotevarying clinical consequence- Undef
    Pending (NBS) 6019heterozygotevarying clinical consequence - Trans
    Pending (NBS) 5996heterozygote
    Pending (NBS) 6090heterozygoteVUS3- Undef
    Pending (NBS) 6092heterozygoteCFTR-RD-causing- Undef
    Pending (NBS) 6095heterozygotevarying clinical consequence- Undef
    Pending (NBS) 6099heterozygoteCF-causing - Trans
    Pending (NBS) 6482heterozygotevarying clinical consequence- Undef
    Pending (NBS) 6100heterozygotevarying clinical consequence- Undef
    Pending (NBS) 6025heterozygoteCFTR-RD-causing - Trans
    Pending (NBS) 6027heterozygoteCFTR-RD-causing- Undef
    Pending (NBS) 6028heterozygotevarying clinical consequence- Undef
    Pending (NBS) 6032heterozygote
    Pending (NBS) 6030heterozygoteCFTR-RD-causing - Trans
    Other 4686heterozygoteCFTR-RD-causing - Trans
    Other 4676heterozygotevarying clinical consequence - Trans
    Other 4690heterozygoteCFTR-RD-causing - Trans
    Other 4698heterozygotevarying clinical consequence - Trans
    Other 4702heterozygoteVUS3 - Trans
    Other 4713heterozygoteCFTR-RD-causing - Trans
    Other 4714heterozygote
    Other 4846heterozygoteCFTR-RD-causing- Undef
    Other 4836heterozygoteVUS3 - Trans
    Other 4844heterozygoteCFTR-RD-causing - Trans
    Other 87heterozygotevarying clinical consequence - Trans
    Other 186heterozygotevarying clinical consequence- Undef
    Other 358heterozygoteCFTR-RD-causing - Trans
    Other 645heterozygoteCFTR-RD-causing- Undef
    Other 752heterozygoteCFTR-RD-causing - Trans
    Other 756heterozygoteCFTR-RD-causing - Trans
    Other 757heterozygotevarying clinical consequence- Undef
    Other 779heterozygoteCFTR-RD-causing - Trans
    Other 801heterozygotevarying clinical consequence - Trans
    Other 815heterozygoteCFTR-RD-causing - Trans
    Other 845heterozygote
    Other 851heterozygoteCFTR-RD-causing - Trans
    Other 864heterozygoteVUS3 - Trans
    Other 937heterozygoteCFTR-RD-causing - Trans
    Other 940heterozygote
    Other 972heterozygote
    Other 983heterozygoteCFTR-RD-causing - Trans
    Other 5743heterozygoteCFTR-RD-causing - Trans
    VUS3- Undef
    Other 5136heterozygote
    Other 5523heterozygoteCFTR-RD-causing- Undef
    Other 5518heterozygoteCFTR-RD-causing- Undef
    Other 5814heterozygoteVUS3- Undef
    Other 5823heterozygoteCFTR-RD-causing- Undef
    non-CF- Undef
    VUS3- Undef
    Other 5825heterozygoteCFTR-RD-causing- Undef
    Other 6355heterozygotevarying clinical consequence - Trans
    Other 6343heterozygoteCFTR-RD-causing- Undef
    Other 6342heterozygoteCFTR-RD-causing- Undef
    Other 6334heterozygoteCFTR-RD-causing- Undef
    Other 5128heterozygotevarying clinical consequence - Trans
    Other 5810heterozygotenon-CF- Undef
    Other 1024heterozygotevarying clinical consequence- Undef
    Other 4770heterozygotelikely CFTR-RD - Trans
    Other 4774heterozygoteCFTR-RD-causing - Trans
    Other 4777heterozygoteVUS3 - Trans
    Other 4799heterozygotevarying clinical consequence- Undef
    VUS3- Undef
    Other 4792heterozygotelikely CFTR-RD - Trans
    Other 4800heterozygoteVUS3- Undef
    VUS3- Undef
    varying clinical consequence- Undef
    Other 1062heterozygoteCFTR-RD-causing - Trans
    Other 5184heterozygotevarying clinical consequence - Trans
    VUS3- Undef
    VUS3- Undef
    Other 1069heterozygotelikely CFTR-RD - Trans
    Other 1082heterozygotevarying clinical consequence - Trans
    Other 1098heterozygotevarying clinical consequence - Trans
    Other 1099heterozygoteCFTR-RD-causing - Trans
    Other 1113heterozygoteCFTR-RD-causing- Undef
    VUS3- Undef
    Other 1136heterozygoteCFTR-RD-causing - Trans
    Other 1141heterozygoteCFTR-RD-causing- Undef
    Other 1185heterozygotevarying clinical consequence - Trans
    Other 1217heterozygote
    Other 1265heterozygote
    Other 1305heterozygoteVUS3- Undef
    Other 6489heterozygoteVUS2 - Cis
    CFTR-RD-causing- Undef
    Other 1576heterozygoteVUS3 - Trans
    Other 6551heterozygotenon-CF - Trans
    Other 1640heterozygoteVUS3- Undef
    CFTR-RD-causing- Undef
    Other 1676heterozygoteCFTR-RD-causing- Undef
    Other 5367heterozygoteVUS3 - Trans
    Other 5381heterozygoteCFTR-RD-causing- Undef
    Other 5383heterozygoteVUS3 - Trans
    Other 5671heterozygotevarying clinical consequence - Trans
    Other 6218heterozygoteCFTR-RD-causing - Trans
    Other 6402heterozygotenon-CF- Undef
    Other 2021heterozygotevarying clinical consequence- Undef
    Other 2260heterozygotevarying clinical consequence- Undef
    Other 2357heterozygote
    Other 2434heterozygote
    Other 2448heterozygoteCFTR-RD-causing - Trans
    Other 2540heterozygotevarying clinical consequence - Trans
    Other 2544heterozygotevarying clinical consequence - Trans
    Other 4884heterozygotelikely CFTR-RD- Undef
    Other 5716heterozygoteVUS3 - Trans
    Other 2771heterozygoteCFTR-RD-causing - Trans
    Other 4767heterozygote
    Other 5575heterozygoteCFTR-RD-causing- Undef
    Other 2801heterozygoteCFTR-RD-causing - Trans
    Other 2874heterozygoteCFTR-RD-causing - Trans
    Other 4664heterozygoteCFTR-RD-causing- Undef
    Other 2952heterozygoteCFTR-RD-causing - Trans
    Other 3022heterozygotevarying clinical consequence - Trans
    Other 3047heterozygote
    Other 3058heterozygoteCF-causing - Trans
    Other 3076heterozygote
    Other 3246heterozygoteCFTR-RD-causing - Trans
    Other 3247heterozygotevarying clinical consequence- Undef
    Other 3397heterozygoteCFTR-RD-causing - Trans
    Other 3404heterozygotevarying clinical consequence - Trans
    Other 5175heterozygoteVUS3- Undef
    Other 5763heterozygoteCFTR-RD-causing- Undef
    non-CF- Undef
    Other 5360heterozygotevarying clinical consequence - Trans
    Other 5567heterozygoteCFTR-RD-causing - Trans
    Other 5625heterozygoteCFTR-RD-causing - Trans
    Other 5775heterozygoteVUS3- Undef
    VUS3- Undef
    Other 5163heterozygoteVUS3- Undef
    Other 3539heterozygoteCFTR-RD-causing - Trans
    Other 3589heterozygotevarying clinical consequence - Trans
    Other 3608heterozygotevarying clinical consequence - Trans
    Other 5789heterozygoteVUS3- Undef
    Other 6542heterozygotelikely CFTR-RD- Undef
    Other 3881heterozygoteVUS3 - Trans
    Other 5122heterozygoteVUS3 - Trans
    Other 5119heterozygotevarying clinical consequence- Undef
    Other 5120heterozygotevarying clinical consequence - Trans
    Other 4244heterozygotevarying clinical consequence - Trans
    Other 4278heterozygoteVUS3 - Trans
    VUS1- Undef
    Other 4312heterozygoteVUS2- Undef
    Other 4818heterozygotevarying clinical consequence- Undef
    Other 4808heterozygoteCF-causing- Undef
    Other 4810heterozygoteCFTR-RD-causing- Undef
    Other 4812heterozygoteVUS3- Undef
    Other 4338heterozygoteVUS3 - Trans
    Other 4520heterozygoteCFTR-RD-causing- Undef
    Other 4528heterozygotevarying clinical consequence - Trans
    Other 4542heterozygotevarying clinical consequence - Trans
    Other 4546heterozygotevarying clinical consequence- Undef
    Other 4561heterozygotenon-CF- Undef
    Other 4563heterozygoteCFTR-RD-causing - Trans
    VUS3- Undef
    Other 4567heterozygoteVUS3- Undef
    Other 4570heterozygoteVUS3 - Trans
    Other 4600heterozygotevarying clinical consequence- Undef
    Other 4615heterozygoteCFTR-RD-causing- Undef
    Other 5806heterozygoteVUS3- Undef
    Other 6190heterozygotevarying clinical consequence- Undef
    Other 6157heterozygote
    Other 6194heterozygoteCFTR-RD-causing - Trans
    Other 6187heterozygotevarying clinical consequence- Undef
    Other 6467heterozygoteCFTR-RD-causing- Undef
    Other 6474heterozygoteVUS3- Undef
    Other 6114heterozygoteCF-causing - Trans
    Other 6118heterozygoteCF-causing - Trans
    Other 6014heterozygote
    Other 4588homozygotec.1521_1523del - p.(Phe508del) - Trans
    Pending non-CF 4681heterozygotevarying clinical consequence - Trans
    Pending non-CF 4704heterozygoteCFTR-RD-causing - Trans
    Pending non-CF 4677heterozygotevarying clinical consequence - Trans
    Pending non-CF 753heterozygoteVUS3 - Trans
    Pending non-CF 5009heterozygoteVUS3 - Trans
    Pending non-CF 3877heterozygotelikely CFTR-RD - Trans
    Pending non-CF 5121heterozygoteCFTR-RD-causing- Undef
    Pending non-CF 6000heterozygoteVUS3 - Trans
    Fetal bowel anomalies 4670heterozygoteCF-causing - Trans
    Fetal bowel anomalies 253heterozygoteCF-causing - Trans
    Fetal bowel anomalies 323heterozygoteCF-causing - Trans
    Fetal bowel anomalies 366heterozygoteCF-causing - Trans
    Fetal bowel anomalies 375heterozygoteCF-causing - Trans
    Fetal bowel anomalies 578heterozygoteCF-causing - Trans
    Fetal bowel anomalies 584heterozygotevarying clinical consequence - Trans
    Fetal bowel anomalies 677heterozygoteCF-causing - Trans
    Fetal bowel anomalies 760heterozygoteCF-causing - Trans
    Fetal bowel anomalies 771heterozygote
    Fetal bowel anomalies 824heterozygoteCF-causing - Trans
    Fetal bowel anomalies 828heterozygoteCFTR-RD-causing - Trans
    Fetal bowel anomalies 874heterozygoteCF-causing - Trans
    Fetal bowel anomalies 880heterozygoteCF-causing - Trans
    Fetal bowel anomalies 917heterozygoteCF-causing - Trans
    Fetal bowel anomalies 923heterozygoteCF-causing - Trans
    Fetal bowel anomalies 5147heterozygotevarying clinical consequence - Trans
    Fetal bowel anomalies 4958heterozygoteCF-causing - Trans
    Fetal bowel anomalies 1234heterozygoteCF-causing - Trans
    Fetal bowel anomalies 1286heterozygoteCF-causing - Trans
    Fetal bowel anomalies 1302heterozygoteCF-causing - Trans
    Fetal bowel anomalies 1436heterozygoteCF-causing - Trans
    Fetal bowel anomalies 1565heterozygoteCF-causing - Trans
    Fetal bowel anomalies 5435heterozygoteVUS3 - Trans
    Fetal bowel anomalies 5394heterozygoteCF-causing - Trans
    Fetal bowel anomalies 2388heterozygoteCF-causing- Undef
    Fetal bowel anomalies 2487heterozygoteCF-causing- Undef
    Fetal bowel anomalies 2569heterozygoteCF-causing- Undef
    Fetal bowel anomalies 4948heterozygoteCF-causing - Trans
    Fetal bowel anomalies 2692heterozygoteCF-causing - Trans
    Fetal bowel anomalies 3186heterozygoteCF-causing - Trans
    Fetal bowel anomalies 3402heterozygoteCF-causing - Trans
    Fetal bowel anomalies 3403heterozygoteCF-causing - Trans
    Fetal bowel anomalies 5162heterozygoteCF-causing - Trans
    Fetal bowel anomalies 3776heterozygoteCF-causing- Undef
    Fetal bowel anomalies 3865heterozygoteVUS3- Undef
    Fetal bowel anomalies 4020heterozygoteCF-causing- Undef
    Fetal bowel anomalies 4052heterozygoteCF-causing- Undef
    Fetal bowel anomalies 4086heterozygoteCF-causing- Undef
    Fetal bowel anomalies 4246heterozygoteVUS3 - Trans
    Fetal bowel anomalies 4316heterozygoteCFTR-RD-causing - Trans
    Fetal bowel anomalies 4324heterozygoteCF-causing - Trans
    Fetal bowel anomalies 4533heterozygoteCF-causing - Trans
    Fetal bowel anomalies 4873heterozygoteVUS3 - Trans
    Fetal bowel anomalies 5357heterozygotenon-CF - Cis
    VUS3 - Trans
    Fetal bowel anomalies 98homozygotec.1521_1523del - p.(Phe508del) - Trans
    Fetal bowel anomalies 871homozygotec.1521_1523del - p.(Phe508del) - Trans
    Fetal bowel anomalies 1292homozygotec.1521_1523del - p.(Phe508del) - Trans
    Fetal bowel anomalies 1564homozygotec.1521_1523del - p.(Phe508del) - Trans
    Fetal bowel anomalies 3555homozygotec.1521_1523del - p.(Phe508del) - Trans
    Fetal bowel anomalies 3809homozygotec.1521_1523del - p.(Phe508del) - Trans
    Fetal bowel anomalies 3989homozygotec.1521_1523del - p.(Phe508del) - Trans
    Fetal bowel anomalies 4064homozygotec.1521_1523del - p.(Phe508del) - Trans
    Fetal bowel anomalies 4075homozygotec.1521_1523del - p.(Phe508del) - Trans
    Fetal bowel anomalies 4109homozygotec.1521_1523del - p.(Phe508del) - Trans
    Fetal bowel anomalies 4180homozygotec.1521_1523del - p.(Phe508del) - Trans
    Fetal bowel anomalies 4265homozygotec.1521_1523del - p.(Phe508del) - Trans
    Fetal bowel anomalies 4322homozygotec.1521_1523del - p.(Phe508del) - Trans
    Aquagenic palmoplantar keratoderma 4827heterozygoteCFTR-RD-causing- Undef
    Aquagenic palmoplantar keratoderma 6335heterozygoteCFTR-RD-causing- Undef
    Aquagenic palmoplantar keratoderma 6549heterozygotenon-CF- Undef
    Aquagenic palmoplantar keratoderma 6276heterozygote
    Aquagenic palmoplantar keratoderma 5149heterozygoteCFTR-RD-causing- Undef
    Aquagenic palmoplantar keratoderma 5785heterozygoteCFTR-RD-causing - Trans
    Aquagenic palmoplantar keratoderma 6302heterozygoteVUS3- Undef


    Color code:   non disease-causing <   likely benign <   VUS <   likely pathogenic <   disease-causing



                CFTR variants are clustered into five groups (click here for more details about the classification of variants):
    • CF-causing: when in trans with another CF-causing mutation, will result in CF.
    • CFTR-RD causing: when in trans with a CF-causing mutation, will result in CFTR-related disorders (CFTR-RD) such as chronic pancreatitis, bronchiectasis, CRS-NP (chronic rhinosinusitis with or without nasal polyposis) or CBAVD (congenital absence of vas deferens), according to Bombieri C et al., 2011.
    • Varying clinical consequence: when in trans with another CF-causing mutation, can either result in CF or in a CFTR-RD.
    • Non disease-causing: when in trans with a CF-causing mutation, will not cause CF, nor CFTR-RD.
    • VUS (Variant of unknown clinical significance): unclassified because of insufficient data.



    Go to CFTRare