Variant NM_000492.4:c.1040G>C


Variant details:
Name NM_000492.4:c.1040G>C
Protein name NP_000483.3:p.(Arg347Pro)
Genomic name (hg19) chr7:g.117180324G>C    UCSC    
#Exon/intron exon 8
Legacy Name R347P
Class disease-causing
Subclass CF-causing
WT sequence ACCATCTCATTCTGCATTGTTCTGC G CATGGCGGTCACTCGGCAATTTCCC
Mutant sequence ACCATCTCATTCTGCATTGTTCTGC C CATGGCGGTCACTCGGCAATTTCCC

Other databases:
dbSNP
rs77932196



Pathogenicity predictors:

Functional studies:


Reference PMID Splicing mRNA level Maturation Localization Channel fonction (Cl-) Bicarbonate
Sheppard et al, 1993 7680769 ✓ ✓ ✓
Van Goor et al, 2014 23891399 ✓ ✓ ✓
Sosnay et al, 2013 23974870 ✓ ✓


« ✓ » indicates the type of analysis performed and not the results


Response to modulators:


Modulator FDA approval EMA approval in vitro / ex vivo data clinical data
IVAnononono
TEZ-IVA yesnoyesno
ELX-TEZ-IVA yesnoyesno


clinical and functional data are provided by Vertex


No patient found in CFTR-NGS catalogue


37 patients carrying this variant are reported in CFTR-France:

TOTAL NUMBER OF PATIENTS 37
CF 27
CFTR-RD9
  • Bronchiectasis  2
  • CBAVD  3
  • CRS-NP  1
  • Other  2
  • Pancreatitis  1
Fetal bowel anomalies 1




Color code:   non disease-causing <   likely benign <   VUS <   likely pathogenic <   disease-causing

Detailed genotypes:
Phenotype Patient ID Variant status Additional variants
CF 45heterozygoteCF-causing - Trans
CF 4923heterozygotevarying clinical consequence- Undef
CF 2712heterozygoteCF-causing - Trans
CF 2893heterozygoteCF-causing- Undef
VUS3- Undef
CF 3209heterozygoteCF-causing- Undef
CF 3210heterozygoteCF-causing- Undef
CF 3378heterozygoteCF-causing - Trans
CF 3503heterozygoteCF-causing- Undef
CF 3626heterozygoteCF-causing- Undef
CF 3696heterozygoteCF-causing- Undef
CF 4348heterozygoteCF-causing- Undef
CF 4394heterozygoteCF-causing- Undef
CF 4397heterozygoteCF-causing - Trans
CF 1886heterozygoteCF-causing- Undef
CF 79heterozygoteCF-causing - Trans
CF 804heterozygoteCF-causing - Trans
CF 820heterozygoteCF-causing - Trans
CF 928heterozygoteCF-causing - Trans
CF 1121heterozygoteCF-causing - Trans
CF 1148heterozygoteCF-causing - Trans
CF 1824heterozygoteCF-causing- Undef
CF 4992heterozygoteCF-causing - Trans
CF 4991heterozygoteCF-causing - Trans
CF 4990heterozygoteCF-causing - Trans
CF 1770heterozygoteCF-causing- Undef
CF 4437heterozygoteCF-causing - Trans
CF 3978homozygotec.1040G>C - p.(Arg347Pro) - Trans
Fetal bowel anomalies 253heterozygoteCF-causing - Trans
CRS-NP 4768heterozygoteCF-causing - Trans
Other 5187heterozygoteCFTR-RD-causing - Trans
Other 1741heterozygotevarying clinical consequence- Undef
CBAVD 4750heterozygoteCFTR-RD-causing- Undef
CBAVD 5768heterozygoteVUS3- Undef
CBAVD 1344heterozygoteCFTR-RD-causing- Undef
Bronchiectasis 4811heterozygote
Bronchiectasis 2127heterozygote
Pancreatitis 2503heterozygote


Color code:   non disease-causing <   likely benign <   VUS <   likely pathogenic <   disease-causing



            CFTR variants are clustered into five groups:
  • CF-causing: when in trans with another CF-causing mutation, will result in CF.
  • CFTR-RD causing: when in trans with a CF-causing mutation, will result in CFTR-related disorders (CFTR-RD) such as chronic pancreatitis, bronchiectasis, CRS-NP (chronic rhinosinusitis with or without nasal polyposis) or CBAVD (congenital absence of vas deferens), according to Bombieri C et al., 2011.
  • Varying clinical consequence: when in trans with another CF-causing mutation, can either result in CF or in a CFTR-RD.
  • Non disease-causing: when in trans with a CF-causing mutation, will not cause CF, nor CFTR-RD.
  • VUS (Variant of unknown clinical significance): unclassified because of insufficient data.



Go to CFTRare