CFTR-France

Variant details:
Name	NM_000492.4:c.1116+1G>A
Protein name	NP_000483.3:p.(=)
Genomic name (hg19)	chr7:g.117180401G>A UCSC
#Exon/intron	intron 8
Legacy Name	1248+1G>A
Class	disease-causing
Subclass	CF-causing
WT sequence	TCTTGGAGCAATAAACAAAATACAG G TAATGTACCATAATGCTGCATTATA
Mutant sequence	TCTTGGAGCAATAAACAAAATACAG A TAATGTACCATAATGCTGCATTATA

Other databases:
		dbSNP rs397508158

Pathogenicity predictors:
Not found

1 individuals carrying this variant are reported in CFTR-NGS catalogue

6 patients carrying this variant are reported in CFTR-France:

Color code: non disease-causing < likely benign < VUS < likely pathogenic < disease-causing

Detailed genotypes:
Phenotype	Patient ID	Variant status	Additional variants
Other	5082	heterozygote	VUS3 - Trans
Other	4963	heterozygote	varying clinical consequence- Undef VUS3- Undef
CBAVD	572	heterozygote	likely CFTR-RD - Trans
CF	1138	heterozygote	CF-causing - Trans
CF	4964	heterozygote	varying clinical consequence- Undef VUS3- Undef
Fetal bowel anomalies	1302	heterozygote	CF-causing - Trans

Color code: non disease-causing < likely benign < VUS < likely pathogenic < disease-causing

CFTR variants are clustered into five groups:

CF-causing: when in trans with another CF-causing mutation, will result in CF.
CFTR-RD causing: when in trans with a CF-causing mutation, will result in CFTR-related disorders (CFTR-RD) such as chronic pancreatitis, bronchiectasis, CRS-NP (chronic rhinosinusitis with or without nasal polyposis) or CBAVD (congenital absence of vas deferens), according to Bombieri C et al., 2011.
Varying clinical consequence: when in trans with another CF-causing mutation, can either result in CF or in a CFTR-RD.
Non disease-causing: when in trans with a CF-causing mutation, will not cause CF, nor CFTR-RD.
VUS (Variant of unknown clinical significance): unclassified because of insufficient data.

Go to