Variant NM_000492.4:c.1684G>A
Name | NM_000492.4:c.1684G>A | ||||
Protein name | NP_000483.3:p.(Val562Ile) | ||||
Genomic name (hg19) | chr7:g.117230411G>A UCSC | ||||
#Exon/intron | exon 13 | ||||
Legacy Name | V562I | ||||
Class | VUS | ||||
Subclass | non-CF | ||||
complex allele in 22.22% of patients associated with WT sequence |
TAATTTCCATTTTCTTTTTAGAGCA G TATACAAAGATGCTGATTTGTATTT |
Mutant sequence |
TAATTTCCATTTTCTTTTTAGAGCA A TATACAAAGATGCTGATTTGTATTT |
|
![]() |
![]() | dbSNP rs1800097 |
![]() | ![]() |
Reference | PMID | Splicing | mRNA level | Maturation | Localization | Channel fonction (Cl-) | Bicarbonate |
Roxo-Rosa et al, 2006 | 17098864 | ✓ | ✓ |
« ✓ » indicates the type of analysis performed and not the results
Modulator | FDA approval | EMA approval | in vitro / ex vivo data | clinical data |
IVA | yes | no | yes | no |
TEZ-IVA | yes | no | yes | no |
ELX-TEZ-IVA | yes | no | yes | no |
clinical and functional data are provided by Vertex
1 individuals carrying this variant are reported in CFTR-NGS catalogue |
TOTAL NUMBER OF PATIENTS | 45 |
---|---|
Asymptomatic compound heterozygote | 2 |
CF | 6 |
CFTR-RD | 34
|
Pending | 1 |
Pending (NBS) | 2 |
Color code: non disease-causing < likely benign < VUS < likely pathogenic < disease-causing |
Phenotype | Patient ID | Variant status | Additional variants |
---|---|---|---|
CBAVD | 2211 | heterozygote | CFTR-RD-causing- Undef non-CF- Undef |
CBAVD | 4333 | heterozygote | varying clinical consequence- Undef non-CF- Undef |
CBAVD | 3318 | heterozygote | CFTR-RD-causing - Cis non-CF - Cis CFTR-RD-causing - Trans |
CBAVD | 919 | heterozygote | CFTR-RD-causing- Undef non-CF- Undef CF-causing- Undef |
CBAVD | 725 | heterozygote | CFTR-RD-causing- Undef non-CF- Undef CF-causing- Undef |
CBAVD | 475 | heterozygote | CFTR-RD-causing- Undef non-CF- Undef CF-causing- Undef |
CBAVD | 400 | heterozygote | varying clinical consequence- Undef CF-causing- Undef non-CF- Undef |
CBAVD | 389 | heterozygote | CFTR-RD-causing- Undef non-CF- Undef |
CBAVD | 1664 | heterozygote | non-CF - Cis varying clinical consequence- Undef |
CBAVD | 1491 | heterozygote | CFTR-RD-causing - Cis non-CF - Cis CF-causing - Trans |
CBAVD | 1464 | heterozygote | CFTR-RD-causing - Cis non-CF - Cis CFTR-RD-causing - Trans |
CBAVD | 1453 | heterozygote | CFTR-RD-causing - Cis non-CF - Cis varying clinical consequence - Trans |
CBAVD | 1353 | heterozygote | CFTR-RD-causing - Cis non-CF - Cis |
CBAVD | 908 | homozygote | c.1210-34_1210-6TG[11]T[5] - Trans c.1466C>T - p.(Ser489Leu) - Trans c.1684G>A - p.(Val562Ile) - Trans |
Bronchiectasis | 5897 | heterozygote | CFTR-RD-causing - Cis non-CF - Cis |
Bronchiectasis | 2217 | heterozygote | CFTR-RD-causing- Undef non-CF- Undef |
Bronchiectasis | 2419 | heterozygote | CFTR-RD-causing- Undef non-CF- Undef |
Bronchiectasis | 2580 | heterozygote | CFTR-RD-causing- Undef non-CF- Undef |
Bronchiectasis | 1810 | heterozygote | CFTR-RD-causing- Undef non-CF- Undef |
Bronchiectasis | 777 | heterozygote | CFTR-RD-causing- Undef non-CF- Undef |
Bronchiectasis | 5001 | heterozygote | CFTR-RD-causing - Cis non-CF - Cis CFTR-RD-causing - Trans VUS3 - Trans |
CF | 6226 | heterozygote | CFTR-RD-causing - Cis non-CF - Cis CFTR-RD-causing - Trans VUS3- Undef |
CF | 5672 | heterozygote | CFTR-RD-causing - Cis CF-causing - Cis non-CF - Cis CF-causing - Trans |
CF | 4942 | heterozygote | CFTR-RD-causing - Cis non-CF - Cis |
CF | 5374 | heterozygote | CFTR-RD-causing - Cis non-CF - Cis CF-causing - Cis CF-causing - Trans |
CF | 1285 | heterozygote | CFTR-RD-causing - Cis CF-causing - Cis non-CF - Cis CF-causing - Trans |
CF | 780 | homozygote | c.1210-34_1210-6TG[11]T[5] - Trans c.1684G>A - p.(Val562Ile) - Trans c.2215del - p.(Val739Tyrfs*16) - Trans |
Asymptomatic compound heterozygote | 5606 | heterozygote | CFTR-RD-causing - Cis non-CF - Cis CF-causing - Trans |
Asymptomatic compound heterozygote | 5220 | heterozygote | CFTR-RD-causing- Undef non-CF- Undef |
Aquagenic palmoplantar keratoderma | 5822 | heterozygote | CFTR-RD-causing- Undef non-CF- Undef |
Other | 4539 | heterozygote | CFTR-RD-causing- Undef non-CF- Undef |
Other | 5763 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef non-CF- Undef |
Other | 5823 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef non-CF- Undef VUS3- Undef |
Pending | 5804 | heterozygote | CFTR-RD-causing - Cis non-CF - Cis varying clinical consequence - Trans VUS3 - Trans |
Pending (NBS) | 4409 | heterozygote | CFTR-RD-causing - Cis non-CF - Cis CF-causing - Trans |
Pending (NBS) | 6216 | heterozygote | CFTR-RD-causing - Cis non-CF - Cis CF-causing - Trans |
Pancreatitis | 2162 | heterozygote | CFTR-RD-causing- Undef non-CF- Undef |
Pancreatitis | 1940 | heterozygote | varying clinical consequence - Cis non-CF - Cis varying clinical consequence - Trans |
Pancreatitis | 6388 | heterozygote | CFTR-RD-causing - Cis non-CF - Cis |
Pancreatitis | 5891 | heterozygote | CFTR-RD-causing - Cis non-CF - Cis CFTR-RD-causing- Undef |
Pancreatitis | 5870 | heterozygote | CFTR-RD-causing- Undef non-CF- Undef CFTR-RD-causing- Undef |
Pancreatitis | 4913 | heterozygote | CFTR-RD-causing- Undef non-CF- Undef |
Pancreatitis | 2486 | heterozygote | CFTR-RD-causing- Undef non-CF- Undef CFTR-RD-causing- Undef |
Pancreatitis | 5456 | heterozygote | CFTR-RD-causing - Cis non-CF - Cis VUS3- Undef |
Pancreatitis | 1673 | heterozygote | CFTR-RD-causing- Undef non-CF- Undef |
Color code: non disease-causing < likely benign < VUS < likely pathogenic < disease-causing |
CFTR variants are clustered into five groups: |
|