Variant NM_000492.4:c.1684G>A


Variant details:
Name NM_000492.4:c.1684G>A
Protein name NP_000483.3:p.(Val562Ile)
Genomic name (hg19) chr7:g.117230411G>A    UCSC    
#Exon/intron exon 13
Legacy Name V562I
Class VUS
Subclass non-CF
complex allele in 23.26% of patients associated with
  • c.1210-12T[5] : 10.00%
  • c.1210-34_1210-6TG[11]T[5] : 90.00%
    • WT sequence TAATTTCCATTTTCTTTTTAGAGCA G TATACAAAGATGCTGATTTGTATTT
    Mutant sequence TAATTTCCATTTTCTTTTTAGAGCA A TATACAAAGATGCTGATTTGTATTT

    Other databases:
    dbSNP
    rs1800097



    Pathogenicity predictors:

    Functional studies:


    Reference PMID Splicing mRNA level Maturation Localization Channel fonction (Cl-) Bicarbonate
    Roxo-Rosa et al, 2006 17098864 ✓ ✓


    « ✓ » indicates the type of analysis performed and not the results


    Response to modulators:


    Modulator FDA approval EMA approval in vitro / ex vivo data clinical data
    IVA yesnoyesno
    TEZ-IVA yesnoyesno
    ELX-TEZ-IVA yesnoyesno


    clinical and functional data are provided by Vertex


    1 individuals carrying this variant are reported in CFTR-NGS catalogue


    43 patients carrying this variant are reported in CFTR-France:

    TOTAL NUMBER OF PATIENTS 43
    Asymptomatic compound heterozygote 2
    CF 5
    CFTR-RD33
    • Aquagenic palmoplantar keratoderma  1
    • Bronchiectasis  7
    • CBAVD  14
    • Other  3
    • Pancreatitis  8
    Pending 1
    Pending (NBS) 2




    Color code:   non disease-causing <   likely benign <   VUS <   likely pathogenic <   disease-causing

    Detailed genotypes:
    Phenotype Patient ID Variant status Additional variants
    CBAVD 2211heterozygoteVUS3- Undef
    CBAVD 4333heterozygotevarying clinical consequence- Undef
    CBAVD 3318heterozygoteVUS3 - Cis
    CFTR-RD-causing - Trans
    CBAVD 919heterozygoteVUS3- Undef
    CF-causing- Undef
    CBAVD 725heterozygoteVUS3- Undef
    CF-causing- Undef
    CBAVD 475heterozygoteVUS3- Undef
    CF-causing- Undef
    CBAVD 400heterozygotevarying clinical consequence- Undef
    CF-causing- Undef
    CBAVD 389heterozygoteVUS3- Undef
    CBAVD 1664heterozygotevarying clinical consequence- Undef
    CBAVD 1491heterozygoteVUS3 - Cis
    CF-causing - Trans
    CBAVD 1464heterozygoteVUS3 - Cis
    CFTR-RD-causing - Trans
    CBAVD 1453heterozygoteVUS3 - Cis
    varying clinical consequence - Trans
    CBAVD 1353heterozygoteVUS3 - Cis
    CBAVD 908homozygotec.1210-34_1210-6TG[11]T[5] - Trans
    c.1466C>T - p.(Ser489Leu) - Trans
    c.1684G>A - p.(Val562Ile) - Trans
    Bronchiectasis 5897heterozygoteVUS3 - Cis
    CFTR-RD-causing- Undef
    CFTR-RD-causing- Undef
    Bronchiectasis 2217heterozygoteVUS3- Undef
    Bronchiectasis 2419heterozygoteVUS3- Undef
    Bronchiectasis 2580heterozygoteVUS3- Undef
    Bronchiectasis 1810heterozygoteVUS3- Undef
    Bronchiectasis 5001heterozygoteVUS3 - Cis
    VUS3 - Trans
    VUS3 - Trans
    Bronchiectasis 777heterozygoteVUS3- Undef
    CF 5672heterozygoteVUS3 - Cis
    CF-causing - Cis
    CF-causing - Trans
    CF 4942heterozygoteVUS3 - Cis
    CF 5374heterozygoteVUS3 - Cis
    CF-causing - Cis
    CF-causing - Trans
    CF 1285heterozygoteVUS3 - Cis
    CF-causing - Cis
    CF-causing - Trans
    CF 780homozygotec.1210-34_1210-6TG[11]T[5] - Trans
    c.1684G>A - p.(Val562Ile) - Trans
    c.2215del - p.(Val739Tyrfs*16) - Trans
    Asymptomatic compound heterozygote 5606heterozygoteVUS3 - Cis
    CF-causing - Trans
    Asymptomatic compound heterozygote 5220heterozygoteVUS3- Undef
    Aquagenic palmoplantar keratoderma 5822heterozygoteVUS3- Undef
    Other 4539heterozygoteVUS3- Undef
    Other 5763heterozygoteVUS3- Undef
    CF-causing- Undef
    Other 5823heterozygoteVUS3- Undef
    CF-causing- Undef
    VUS3- Undef
    Pending 5804heterozygoteVUS3 - Cis
    varying clinical consequence - Trans
    VUS3 - Trans
    Pending (NBS) 4409heterozygoteVUS3 - Cis
    CF-causing - Trans
    Pending (NBS) 6216heterozygoteVUS3 - Cis
    CF-causing - Trans
    Pancreatitis 2162heterozygoteVUS3- Undef
    Pancreatitis 1940heterozygotevarying clinical consequence - Cis
    varying clinical consequence - Trans
    Pancreatitis 5891heterozygoteVUS3 - Cis
    CFTR-RD-causing- Undef
    Pancreatitis 5870heterozygoteVUS3- Undef
    CFTR-RD-causing- Undef
    Pancreatitis 5456heterozygoteVUS3 - Cis
    VUS3- Undef
    Pancreatitis 2486heterozygoteVUS3- Undef
    CFTR-RD-causing- Undef
    Pancreatitis 4913heterozygoteVUS3- Undef
    Pancreatitis 1673heterozygoteVUS3- Undef


    Color code:   non disease-causing <   likely benign <   VUS <   likely pathogenic <   disease-causing



                CFTR variants are clustered into five groups:
    • CF-causing: when in trans with another CF-causing mutation, will result in CF.
    • CFTR-RD causing: when in trans with a CF-causing mutation, will result in CFTR-related disorders (CFTR-RD) such as chronic pancreatitis, bronchiectasis, CRS-NP (chronic rhinosinusitis with or without nasal polyposis) or CBAVD (congenital absence of vas deferens), according to Bombieri C et al., 2011.
    • Varying clinical consequence: when in trans with another CF-causing mutation, can either result in CF or in a CFTR-RD.
    • Non disease-causing: when in trans with a CF-causing mutation, will not cause CF, nor CFTR-RD.
    • VUS (Variant of unknown clinical significance): unclassified because of insufficient data.



    Go to CFTRare