| 2024-10-14 | Class updated from VUS1 to unclassified /probably non-CF |
Variant NM_000492.4:c.1684G>A
| Name | NM_000492.4:c.1684G>A | ||||
| Protein name | NP_000483.3:p.(Val562Ile) | ||||
| Genomic name (hg19) | chr7:g.117230411G>A UCSC | ||||
| Genomic name (hg38) | chr7:g.117590357G>A UCSC | ||||
| #Exon/intron | exon 13 | ||||
| Legacy Name | V562I | ||||
| Class | VUS | ||||
| Subclass | non-CF | ||||
complex allele in 21.74% of patients associated with | WT sequence |
TAATTTCCATTTTCTTTTTAGAGCA G TATACAAAGATGCTGATTTGTATTT |
Mutant sequence |
TAATTTCCATTTTCTTTTTAGAGCA A TATACAAAGATGCTGATTTGTATTT |
|
![]() |
![]() | dbSNP rs1800097 |
![]() | ![]() |
| Reference | PMID | Splicing | mRNA level | Maturation | Localization | Channel fonction (Cl-) | Bicarbonate |
| Roxo-Rosa et al, 2006 | 17098864 | ✓ | ✓ |
« ✓ » indicates the type of analysis performed and not the results
| Modulator | FDA approval | EMA approval | in vitro / ex vivo data | clinical data |
| IVA | yes | no | yes | no |
| TEZ-IVA | yes | no | yes | no |
| ELX-TEZ-IVA | yes | no | yes | no |
| VNZ-TEZ-DIVA | yes | no | no | yes |
clinical and functional data presented above are provided by Vertex
1 individuals carrying this variant are reported in CFTR-NGS catalogue |
| TOTAL NUMBER OF PATIENTS | 46 |
|---|---|
| Asymptomatic compound heterozygote | 2 |
| CF | 5 |
| CFTR-RD | 36
|
| Pending | 1 |
| Pending (NBS) | 2 |
| Color code: non disease-causing < likely benign < VUS < likely pathogenic < disease-causing |
| Phenotype | Patient ID | Variant status | Additional variants |
|---|---|---|---|
| CBAVD | 2211 | heterozygote | CFTR-RD-causing- Undef |
| CBAVD | 4333 | heterozygote | varying clinical consequence- Undef |
| CBAVD | 6454 | heterozygote | CFTR-RD-causing - Cis CFTR-RD-causing- Undef |
| CBAVD | 3318 | heterozygote | CFTR-RD-causing - Cis CFTR-RD-causing - Trans |
| CBAVD | 919 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
| CBAVD | 725 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
| CBAVD | 475 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
| CBAVD | 400 | heterozygote | varying clinical consequence- Undef CF-causing- Undef |
| CBAVD | 1353 | heterozygote | CFTR-RD-causing - Cis |
| CBAVD | 1664 | heterozygote | varying clinical consequence- Undef |
| CBAVD | 1491 | heterozygote | CFTR-RD-causing - Cis CF-causing - Trans |
| CBAVD | 1464 | heterozygote | CFTR-RD-causing - Cis CFTR-RD-causing - Trans |
| CBAVD | 1453 | heterozygote | CFTR-RD-causing - Cis varying clinical consequence - Trans |
| CBAVD | 389 | heterozygote | CFTR-RD-causing- Undef |
| CBAVD | 908 | homozygote | c.1210-34_1210-6TG[11]T[5] - Trans c.1466C>T - p.(Ser489Leu) - Trans c.1684G>A - p.(Val562Ile) - Trans |
| Bronchiectasis | 5897 | heterozygote | CFTR-RD-causing - Cis |
| Bronchiectasis | 2217 | heterozygote | CFTR-RD-causing- Undef |
| Bronchiectasis | 2419 | heterozygote | CFTR-RD-causing- Undef |
| Bronchiectasis | 2580 | heterozygote | CFTR-RD-causing- Undef |
| Bronchiectasis | 777 | heterozygote | CFTR-RD-causing- Undef |
| Bronchiectasis | 1810 | heterozygote | CFTR-RD-causing- Undef |
| Bronchiectasis | 5001 | heterozygote | CFTR-RD-causing - Cis CFTR-RD-causing - Trans VUS3 - Trans |
| CF | 5672 | heterozygote | CFTR-RD-causing - Cis CF-causing - Cis CF-causing - Trans |
| CF | 4942 | heterozygote | CFTR-RD-causing - Cis |
| CF | 5374 | heterozygote | CFTR-RD-causing - Cis CF-causing - Cis CF-causing - Trans |
| CF | 1285 | heterozygote | CFTR-RD-causing - Cis CF-causing - Cis CF-causing - Trans |
| CF | 780 | homozygote | c.1210-34_1210-6TG[11]T[5] - Trans c.1684G>A - p.(Val562Ile) - Trans c.2215del - p.(Val739Tyrfs*16) - Trans |
| Asymptomatic compound heterozygote | 5606 | heterozygote | CFTR-RD-causing - Cis CF-causing - Trans |
| Asymptomatic compound heterozygote | 5220 | heterozygote | CFTR-RD-causing- Undef |
| Aquagenic palmoplantar keratoderma | 5822 | heterozygote | CFTR-RD-causing- Undef |
| Other | 4539 | heterozygote | CFTR-RD-causing- Undef |
| Other | 6226 | heterozygote | CFTR-RD-causing - Cis CFTR-RD-causing - Trans VUS3- Undef |
| Other | 5763 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
| Other | 5823 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef VUS3- Undef |
| Pending | 5804 | heterozygote | CFTR-RD-causing - Cis varying clinical consequence - Trans VUS3 - Trans |
| Pending (NBS) | 4409 | heterozygote | CFTR-RD-causing - Cis CF-causing - Trans |
| Pending (NBS) | 6216 | heterozygote | CFTR-RD-causing - Cis CF-causing - Trans |
| Pancreatitis | 2162 | heterozygote | CFTR-RD-causing- Undef |
| Pancreatitis | 1940 | heterozygote | varying clinical consequence - Cis varying clinical consequence - Trans |
| Pancreatitis | 6388 | heterozygote | CFTR-RD-causing - Cis |
| Pancreatitis | 5891 | heterozygote | CFTR-RD-causing - Cis CFTR-RD-causing- Undef |
| Pancreatitis | 5870 | heterozygote | CFTR-RD-causing- Undef CFTR-RD-causing- Undef |
| Pancreatitis | 2486 | heterozygote | CFTR-RD-causing- Undef CFTR-RD-causing- Undef |
| Pancreatitis | 4913 | heterozygote | CFTR-RD-causing- Undef |
| Pancreatitis | 5456 | heterozygote | CFTR-RD-causing - Cis VUS3- Undef |
| Pancreatitis | 1673 | heterozygote | CFTR-RD-causing- Undef |
| Color code: non disease-causing < likely benign < VUS < likely pathogenic < disease-causing |
| CFTR variants are clustered into five groups (click here for more details about the classification of variants): |
|