Variant NM_000492.4:c.2002C>T


Variant details:
Name NM_000492.4:c.2002C>T
Protein name NP_000483.3:p.(Arg668Cys)
Genomic name (hg19) chr7:g.117232223C>T    UCSC    
#Exon/intron exon 14
Legacy Name R668C
Class disease-causing
Subclass CFTR-RD-causing
complex allele in 69.70% of patients associated with
  • c.1327G>T - p.(Asp443Tyr) : 57.61%
  • c.1727G>C - p.(Gly576Ala) : 98.91%
    • WT sequence TTCAATCCTAACTGAGACCTTACAC C GTTTCTCATTAGAAGGAGATGCTCC
    Mutant sequence TTCAATCCTAACTGAGACCTTACAC T GTTTCTCATTAGAAGGAGATGCTCC

    Other databases:
    dbSNP
    rs1800100



    Pathogenicity predictors:

    Functional studies:


    Reference PMID Splicing mRNA level Maturation Localization Channel fonction (Cl-) Bicarbonate
    El-Seedy et al, 2012 22678879 ✓ ✓ ✓
    Van Goor et al, 2014 23891399 ✓ ✓ ✓
    Sosnay et al, 2013 23974870 ✓ ✓
    Bergougnoux et al, 2015 25797027 ✓ ✓ ✓


    « ✓ » indicates the type of analysis performed and not the results


    Response to modulators:


    Modulator FDA approval EMA approval in vitro / ex vivo data clinical data
    IVA yesnoyesno
    TEZ-IVA yesnoyesno
    ELX-TEZ-IVA yesnoyesno


    clinical and functional data are provided by Vertex


    1 individuals carrying this variant are reported in CFTR-NGS catalogue


    132 patients carrying this variant are reported in CFTR-France:

    TOTAL NUMBER OF PATIENTS 132
    Asymptomatic compound heterozygote 18
    CF 8
    CFTR-RD98
    • Aquagenic palmoplantar keratoderma  2
    • Bronchiectasis  8
    • CBAVD  58
    • CRS-NP  2
    • Other  13
    • Pancreatitis  15
    Fetal bowel anomalies 1
    Pending 4
    Pending (NBS) 2
    Pending non-CF 1




    Color code:   non disease-causing <   likely benign <   VUS <   likely pathogenic <   disease-causing

    Detailed genotypes:
    Phenotype Patient ID Variant status Additional variants
    CF 2495heterozygoteCF-causing- Undef
    CF-causing- Undef
    CF 4360heterozygoteCF-causing- Undef
    CF-causing- Undef
    CF 4665heterozygoteVUS3- Undef
    CF 5215heterozygoteVUS3- Undef
    CFTR-RD-causing- Undef
    CF 294heterozygoteVUS1- Undef
    CF 5053heterozygoteCF-causing- Undef
    VUS3- Undef
    CF 1559heterozygoteCF-causing- Undef
    CF-causing- Undef
    CF 1128heterozygoteCF-causing - Cis
    varying clinical consequence - Trans
    Other 4627heterozygoteCFTR-RD-causing - Trans
    Other 2433heterozygoteVUS3- Undef
    Other 4458heterozygoteCF-causing - Trans
    Other 4570heterozygoteCFTR-RD-causing - Cis
    CF-causing - Trans
    Other 4809heterozygoteCFTR-RD-causing - Cis
    CF-causing- Undef
    Other 4262heterozygoteCF-causing - Trans
    Other 4278heterozygoteCFTR-RD-causing - Cis
    CF-causing - Trans
    VUS1- Undef
    Other 972heterozygoteCF-causing - Trans
    Other 5264heterozygoteCFTR-RD-causing- Undef
    CF-causing- Undef
    Other 5353heterozygoteVUS3- Undef
    Other 4671heterozygoteVUS3- Undef
    Other 5083heterozygoteCFTR-RD-causing- Undef
    CF-causing- Undef
    Other 5814heterozygoteCFTR-RD-causing- Undef
    CF-causing- Undef
    Fetal bowel anomalies 4672heterozygoteCFTR-RD-causing - Trans
    CBAVD 4646heterozygoteCFTR-RD-causing - Cis
    CF-causing - Trans
    CBAVD 4752heterozygoteCFTR-RD-causing- Undef
    CF-causing- Undef
    CBAVD 2989heterozygoteCFTR-RD-causing - Cis
    CF-causing - Trans
    CBAVD 3335heterozygoteCFTR-RD-causing - Cis
    CF-causing - Trans
    CBAVD 5590heterozygoteCFTR-RD-causing - Cis
    CF-causing - Trans
    CBAVD 5764heterozygoteCFTR-RD-causing- Undef
    CF-causing- Undef
    CBAVD 2853heterozygoteCFTR-RD-causing - Cis
    CF-causing - Trans
    CBAVD 2411heterozygote
    CBAVD 2485heterozygoteCFTR-RD-causing - Cis
    CF-causing- Undef
    VUS3- Undef
    CBAVD 2551heterozygoteCF-causing- Undef
    CBAVD 2756heterozygoteCFTR-RD-causing - Cis
    CF-causing- Undef
    CBAVD 2806heterozygoteCFTR-RD-causing - Cis
    CF-causing- Undef
    CBAVD 2824heterozygoteCFTR-RD-causing - Cis
    CF-causing- Undef
    CBAVD 5610heterozygoteCFTR-RD-causing - Cis
    CF-causing - Trans
    CBAVD 4532heterozygotevarying clinical consequence- Undef
    CBAVD 4534heterozygoteCFTR-RD-causing - Cis
    CF-causing- Undef
    CBAVD 4571heterozygoteCFTR-RD-causing- Undef
    CF-causing- Undef
    CBAVD 4574heterozygoteCFTR-RD-causing- Undef
    CF-causing- Undef
    CBAVD 4612heterozygoteCFTR-RD-causing- Undef
    CF-causing- Undef
    CBAVD 4331heterozygoteCFTR-RD-causing - Cis
    CF-causing - Trans
    CBAVD 5943heterozygoteCFTR-RD-causing- Undef
    CF-causing- Undef
    CBAVD 5947heterozygoteCFTR-RD-causing- Undef
    CF-causing- Undef
    CBAVD 4279heterozygoteCFTR-RD-causing - Cis
    CF-causing- Undef
    CBAVD 508heterozygoteCFTR-RD-causing - Cis
    CFTR-RD-causing - Trans
    CBAVD 511heterozygoteCFTR-RD-causing - Cis
    VUS3 - Trans
    CBAVD 549heterozygoteCFTR-RD-causing- Undef
    CF-causing- Undef
    CBAVD 556heterozygoteCFTR-RD-causing- Undef
    CF-causing- Undef
    CBAVD 658heterozygoteCFTR-RD-causing- Undef
    CF-causing- Undef
    CBAVD 659heterozygoteCFTR-RD-causing- Undef
    VUS3- Undef
    CBAVD 682heterozygoteCFTR-RD-causing - Cis
    CF-causing - Trans
    CBAVD 763heterozygoteCFTR-RD-causing - Cis
    CF-causing - Trans
    CBAVD 900heterozygoteCFTR-RD-causing- Undef
    CF-causing- Undef
    CBAVD 497heterozygoteCFTR-RD-causing- Undef
    CF-causing- Undef
    CBAVD 480heterozygoteCFTR-RD-causing- Undef
    CF-causing- Undef
    CBAVD 452heterozygoteCFTR-RD-causing- Undef
    CF-causing- Undef
    CBAVD 4683heterozygoteCFTR-RD-causing- Undef
    CF-causing- Undef
    CBAVD 4722heterozygoteCFTR-RD-causing- Undef
    CF-causing- Undef
    CBAVD 4735heterozygoteCFTR-RD-causing - Cis
    varying clinical consequence - Trans
    CBAVD 395heterozygoteCFTR-RD-causing - Cis
    CF-causing - Trans
    CBAVD 404heterozygoteCFTR-RD-causing - Cis
    varying clinical consequence- Undef
    CBAVD 430heterozygoteCFTR-RD-causing - Cis
    CF-causing - Trans
    CBAVD 433heterozygoteCFTR-RD-causing - Cis
    CF-causing- Undef
    CBAVD 1833heterozygoteCF-causing- Undef
    CBAVD 5463heterozygoteCFTR-RD-causing - Cis
    CF-causing - Trans
    CBAVD 5665heterozygoteCFTR-RD-causing - Cis
    CFTR-RD-causing - Trans
    CBAVD 5882heterozygoteCFTR-RD-causing - Cis
    CF-causing - Trans
    CBAVD 2078heterozygoteVUS3- Undef
    CF-causing- Undef
    CBAVD 2141heterozygoteCF-causing- Undef
    CBAVD 5181heterozygoteCFTR-RD-causing - Cis
    CF-causing - Trans
    VUS3- Undef
    CBAVD 1248heterozygoteCFTR-RD-causing - Cis
    CF-causing- Undef
    CBAVD 1335heterozygoteCFTR-RD-causing - Cis
    CF-causing- Undef
    CBAVD 1340heterozygoteCFTR-RD-causing - Cis
    CF-causing- Undef
    CBAVD 1365heterozygoteCFTR-RD-causing - Cis
    CF-causing- Undef
    CBAVD 1381heterozygoteCFTR-RD-causing - Cis
    CBAVD 1387heterozygote
    CBAVD 1423heterozygoteCFTR-RD-causing - Cis
    CF-causing- Undef
    CBAVD 1510heterozygoteCFTR-RD-causing - Cis
    CF-causing- Undef
    CBAVD 1512heterozygoteCFTR-RD-causing - Cis
    CF-causing- Undef
    Asymptomatic compound heterozygote 2966heterozygoteCF-causing - Trans
    Asymptomatic compound heterozygote 3257heterozygoteCFTR-RD-causing - Cis
    CF-causing - Trans
    Asymptomatic compound heterozygote 2808heterozygotevarying clinical consequence- Undef
    Asymptomatic compound heterozygote 5601heterozygoteCF-causing - Trans
    Asymptomatic compound heterozygote 5602heterozygoteCFTR-RD-causing - Cis
    VUS3 - Trans
    Asymptomatic compound heterozygote 4345heterozygoteCF-causing - Trans
    Asymptomatic compound heterozygote 4358heterozygoteCF-causing - Trans
    Asymptomatic compound heterozygote 4422heterozygoteCFTR-RD-causing - Cis
    VUS3 - Trans
    Asymptomatic compound heterozygote 5964heterozygoteCFTR-RD-causing - Cis
    CF-causing - Trans
    Asymptomatic compound heterozygote 4260heterozygoteCFTR-RD-causing - Cis
    CFTR-RD-causing - Trans
    Asymptomatic compound heterozygote 2142heterozygoteCF-causing- Undef
    Asymptomatic compound heterozygote 5073heterozygote
    Asymptomatic compound heterozygote 5081heterozygote
    Asymptomatic compound heterozygote 5077heterozygoteVUS3- Undef
    Asymptomatic compound heterozygote 4961heterozygoteCF-causing- Undef
    Asymptomatic compound heterozygote 5141heterozygoteVUS3 - Trans
    Asymptomatic compound heterozygote 5705heterozygoteVUS3- Undef
    Asymptomatic compound heterozygote 1290heterozygoteCFTR-RD-causing - Trans
    Pending non-CF 4825heterozygoteCFTR-RD-causing - Cis
    varying clinical consequence - Trans
    Bronchiectasis 2243heterozygoteCF-causing- Undef
    Bronchiectasis 2838heterozygoteCFTR-RD-causing- Undef
    Bronchiectasis 4308heterozygote
    Bronchiectasis 1844heterozygoteCF-causing- Undef
    Bronchiectasis 5669heterozygoteCFTR-RD-causing - Cis
    VUS3 - Trans
    Bronchiectasis 5897heterozygoteVUS3- Undef
    non-CF- Undef
    CFTR-RD-causing- Undef
    Bronchiectasis 4974heterozygoteVUS3- Undef
    Bronchiectasis 5126heterozygoteCFTR-RD-causing- Undef
    Pancreatitis 2984heterozygoteCFTR-RD-causing- Undef
    Pancreatitis 3072heterozygoteCF-causing - Trans
    Pancreatitis 5340heterozygoteVUS3- Undef
    Pancreatitis 2318heterozygote
    Pancreatitis 2338heterozygoteCFTR-RD-causing - Cis
    Pancreatitis 4898heterozygoteCFTR-RD-causing- Undef
    Pancreatitis 2748heterozygoteCFTR-RD-causing- Undef
    Pancreatitis 4240heterozygoteCF-causing - Trans
    VUS3 - Trans
    Pancreatitis 4258heterozygote
    Pancreatitis 4301heterozygote
    Pancreatitis 6201heterozygote
    Pancreatitis 5458heterozygoteVUS3- Undef
    Pancreatitis 5740heterozygoteCFTR-RD-causing - Cis
    Pancreatitis 2065heterozygote
    Pancreatitis 4996homozygotec.1210-34_1210-6TG[11]T[5] - Trans
    c.1327G>T - p.(Asp443Tyr) - Trans
    c.2002C>T - p.(Arg668Cys) - Trans
    Pending 2360heterozygote
    Pending 2843heterozygoteCFTR-RD-causing - Cis
    CF-causing - Trans
    Pending 4304heterozygoteCFTR-RD-causing - Cis
    Pending 4505heterozygoteCF-causing - Trans
    CRS-NP 3043heterozygoteCFTR-RD-causing - Cis
    CF-causing - Trans
    CRS-NP 4805heterozygote
    Aquagenic palmoplantar keratoderma 4660heterozygotevarying clinical consequence - Trans
    Aquagenic palmoplantar keratoderma 5086heterozygotelikely CFTR-RD- Undef
    Pending (NBS) 4420heterozygoteCFTR-RD-causing - Trans
    Pending (NBS) 4806heterozygote


    Color code:   non disease-causing <   likely benign <   VUS <   likely pathogenic <   disease-causing



                CFTR variants are clustered into five groups:
    • CF-causing: when in trans with another CF-causing mutation, will result in CF.
    • CFTR-RD causing: when in trans with a CF-causing mutation, will result in CFTR-related disorders (CFTR-RD) such as chronic pancreatitis, bronchiectasis, CRS-NP (chronic rhinosinusitis with or without nasal polyposis) or CBAVD (congenital absence of vas deferens), according to Bombieri C et al., 2011.
    • Varying clinical consequence: when in trans with another CF-causing mutation, can either result in CF or in a CFTR-RD.
    • Non disease-causing: when in trans with a CF-causing mutation, will not cause CF, nor CFTR-RD.
    • VUS (Variant of unknown clinical significance): unclassified because of insufficient data.



    Go to CFTRare