Variant NM_000492.4:c.1327G>T


Variant details:
Name NM_000492.4:c.1327G>T
Protein name NP_000483.3:p.(Asp443Tyr)
Genomic name (hg19) chr7:g.117188812G>T    UCSC    
#Exon/intron exon 10
Legacy Name D443Y
Class likely benign
complex allele in 68.75% of patients associated with
  • c.1727G>C - p.(Gly576Ala) : 100.00%
  • c.2002C>T - p.(Arg668Cys) : 98.18%
  • WT sequence ACTTCTTGGTACTCCTGTCCTGAAA G ATATTAATTTCAAGATAGAAAGAGG
    Mutant sequence ACTTCTTGGTACTCCTGTCCTGAAA T ATATTAATTTCAAGATAGAAAGAGG


    Effects of associated complex alleles:
    G576A non disease-causing
    R668C non disease-causing
    G576A ; R668C non disease-causing
    D443Y ; G576A ; R668C disease-causing - CFTR-RD-causing




    Other databases:
    dbSNP
    rs147422190



    Pathogenicity predictors:


    Reference PMID Splicing mRNA level Maturation Localization Channel fonction (Cl-) Bicarbonate
    El-Seedy et al, 2012 22678879


    « ✓ » indicates the type of analysis performed and not the results



    Modulator FDA approval EMA approval in vitro / ex vivo data clinical data
    IVAnononono
    TEZ-IVA yesnoyesno
    ELX-TEZ-IVA yesnoyesno


    clinical and functional data are provided by Vertex


    No patient found in CFTR-NGS catalogue


    80 patients carrying this variant are reported in CFTR-France:

    TOTAL NUMBER OF PATIENTS 80
    Asymptomatic compound heterozygote 5
    CF 1
    CFTR-RD71
    • Bronchiectasis  3
    • CBAVD  58
    • CRS-NP  1
    • Other  6
    • Pancreatitis  3
    Pending 2
    Pending non-CF 1




    Color code:   non disease-causing <   likely benign <   VUS <   likely pathogenic <   disease-causing

    Detailed genotypes:
    Phenotype Patient ID Variant status Additional variants
    CBAVD 4612heterozygoteCF-causing- Undef
    CBAVD 2853heterozygoteCF-causing - Trans
    CBAVD 4646heterozygoteCF-causing - Trans
    CBAVD 4752heterozygoteCF-causing- Undef
    CBAVD 2989heterozygoteCF-causing - Trans
    CBAVD 3335heterozygoteCF-causing - Trans
    CBAVD 5590heterozygoteCF-causing - Trans
    CBAVD 2824heterozygoteCF-causing- Undef
    CBAVD 5882heterozygoteCF-causing - Trans
    CBAVD 6223heterozygotevarying clinical consequence- Undef
    VUS3- Undef
    CBAVD 6389heterozygoteCF-causing - Trans
    CBAVD 2485heterozygoteCF-causing- Undef
    VUS3- Undef
    CBAVD 2756heterozygoteCF-causing- Undef
    CBAVD 2806heterozygoteCF-causing- Undef
    CBAVD 5764heterozygoteCF-causing- Undef
    CBAVD 6321heterozygoteCF-causing- Undef
    CBAVD 4331heterozygoteCF-causing - Trans
    CBAVD 4534heterozygoteCF-causing- Undef
    CBAVD 4571heterozygoteCF-causing- Undef
    CBAVD 4574heterozygoteCF-causing- Undef
    CBAVD 6317heterozygoteCF-causing- Undef
    CBAVD 6318heterozygoteCF-causing- Undef
    CBAVD 5610heterozygoteCF-causing - Trans
    CBAVD 5943heterozygoteCF-causing- Undef
    CBAVD 5947heterozygoteCF-causing- Undef
    CBAVD 4279heterozygoteCF-causing- Undef
    CBAVD 508heterozygoteCFTR-RD-causing - Trans
    CBAVD 511heterozygoteVUS3 - Trans
    CBAVD 549heterozygoteCF-causing- Undef
    CBAVD 556heterozygoteCF-causing- Undef
    CBAVD 658heterozygoteCF-causing- Undef
    CBAVD 659heterozygoteVUS3- Undef
    CBAVD 682heterozygoteCF-causing - Trans
    CBAVD 763heterozygoteCF-causing - Trans
    CBAVD 497heterozygoteCF-causing- Undef
    CBAVD 480heterozygoteCF-causing- Undef
    CBAVD 4722heterozygoteCF-causing- Undef
    CBAVD 4735heterozygotevarying clinical consequence - Trans
    CBAVD 395heterozygoteCF-causing - Trans
    CBAVD 404heterozygotevarying clinical consequence- Undef
    CBAVD 430heterozygoteCF-causing - Trans
    CBAVD 433heterozygoteCF-causing- Undef
    CBAVD 452heterozygoteCF-causing- Undef
    CBAVD 900heterozygoteCF-causing- Undef
    CBAVD 5665heterozygoteCFTR-RD-causing - Trans
    CBAVD 5463heterozygoteCF-causing - Trans
    CBAVD 1745heterozygoteCFTR-RD-causing- Undef
    CBAVD 1512heterozygoteCF-causing- Undef
    CBAVD 1510heterozygoteCF-causing- Undef
    CBAVD 1423heterozygoteCF-causing- Undef
    CBAVD 1381heterozygote
    CBAVD 1365heterozygoteCF-causing- Undef
    CBAVD 1340heterozygoteCF-causing- Undef
    CBAVD 1335heterozygoteCF-causing- Undef
    CBAVD 6341heterozygoteCF-causing- Undef
    CBAVD 5181heterozygoteCF-causing - Trans
    VUS3- Undef
    CBAVD 1248heterozygoteCF-causing- Undef
    CBAVD 4683heterozygoteCF-causing- Undef
    Other 4809heterozygoteCF-causing- Undef
    Other 4570heterozygoteCF-causing - Trans
    Other 4278heterozygoteCF-causing - Trans
    VUS1- Undef
    Other 5083heterozygoteCF-causing- Undef
    Other 5264heterozygoteCF-causing- Undef
    Other 5814heterozygoteCF-causing- Undef
    Pending non-CF 4825heterozygotevarying clinical consequence - Trans
    CF 5215heterozygoteCFTR-RD-causing- Undef
    Bronchiectasis 6282heterozygoteCF-causing - Trans
    Bronchiectasis 5669heterozygoteVUS3 - Trans
    Bronchiectasis 5126heterozygote
    Pancreatitis 2338heterozygote
    Pancreatitis 5740heterozygote
    Pancreatitis 4996homozygotec.1210-34_1210-6TG[11]T[5] - Trans
    c.1327G>T - p.(Asp443Tyr) - Trans
    Pending 2843heterozygoteCF-causing - Trans
    Pending 4304heterozygote
    CRS-NP 3043heterozygoteCF-causing - Trans
    Asymptomatic compound heterozygote 3257heterozygoteCF-causing - Trans
    Asymptomatic compound heterozygote 5602heterozygoteVUS3 - Trans
    Asymptomatic compound heterozygote 4422heterozygoteVUS3 - Trans
    Asymptomatic compound heterozygote 5964heterozygoteCF-causing - Trans
    Asymptomatic compound heterozygote 4260heterozygoteCFTR-RD-causing - Trans


    Color code:   non disease-causing <   likely benign <   VUS <   likely pathogenic <   disease-causing



                CFTR variants are clustered into five groups:
    • CF-causing: when in trans with another CF-causing mutation, will result in CF.
    • CFTR-RD causing: when in trans with a CF-causing mutation, will result in CFTR-related disorders (CFTR-RD) such as chronic pancreatitis, bronchiectasis, CRS-NP (chronic rhinosinusitis with or without nasal polyposis) or CBAVD (congenital absence of vas deferens), according to Bombieri C et al., 2011.
    • Varying clinical consequence: when in trans with another CF-causing mutation, can either result in CF or in a CFTR-RD.
    • Non disease-causing: when in trans with a CF-causing mutation, will not cause CF, nor CFTR-RD.
    • VUS (Variant of unknown clinical significance): unclassified because of insufficient data.



    Go to CFTRare