Variant NM_000492.4:c.2930C>T


Variant details:
Name NM_000492.4:c.2930C>T
Protein name NP_000483.3:p.(Ser977Phe)
Genomic name (hg19)     chr7:g.117246749C>T    UCSC    
Genomic name (hg38) chr7:g.117606695C>T    UCSC
#Exon/intron exon 18
Legacy Name S977F
Class disease-causing
Subclass varying clinical consequence
complex allele in 27.27% of patients associated with
  • c.1210-34_1210-6TG[12]T[5] : 100.00%
    • WT sequence ATAGGTGGGATTCTTAATAGATTCT C CAAAGATATAGCAATTTTGGATGAC
    Mutant sequence ATAGGTGGGATTCTTAATAGATTCT T CAAAGATATAGCAATTTTGGATGAC

    Other databases:
    dbSNP
    rs141033578



    Pathogenicity predictors:

    Functional studies:         +


    Reference PMID Splicing mRNA level Maturation Localization Channel fonction (Cl-) Bicarbonate
    Van Goor et al, 2014 23891399 ✓ ✓ ✓
    Sosnay et al, 2013 23974870 ✓ ✓


    « ✓ » indicates the type of analysis performed and not the results


    Response to modulators:         +


    Modulator FDA approval EMA approval in vitro / ex vivo data clinical data
    IVA yesnono yes
    TEZ-IVA yes yesno yes
    ELX-TEZ-IVA yesnoyesno
    VNZ-TEZ-DIVA yesnoyesno

    clinical and functional data presented above are provided by Vertex



    Reference PMID Modulator in vitro / ex vivo data clinical data Patient responsiveness
    Burgel et al., 2024 39151434 ELX-TEZ-IVAN.D. yes yes

    variant responsiveness based on clinical data, sweat chloride concentration, ppFEV1, chest CT imaging before and after ETI treatment (n>3 for 6-8 weeks)


    No patient found in CFTR-NGS catalogue


    22 patients carrying this variant are reported in CFTR-France:

    TOTAL NUMBER OF PATIENTS 22
    Asymptomatic compound heterozygote 1
    CF 6
    CFTR-RD12
    • Bronchiectasis  1
    • CBAVD  6
    • CRS-NP  1
    • Other  1
    • Pancreatitis  3
    Pending 1
    Pending (NBS) 2




    Color code:   non disease-causing <   likely benign <   VUS <   likely pathogenic <   disease-causing

    Detailed genotypes:
    Phenotype Patient ID Variant status Additional variants
    CBAVD 653heterozygoteCFTR-RD-causing- Undef
    varying clinical consequence- Undef
    CBAVD 3394heterozygoteCFTR-RD-causing - Cis
    CF-causing - Trans
    CBAVD 5022heterozygoteCFTR-RD-causing - Cis
    CFTR-RD-causing - Trans
    VUS3- Undef
    CBAVD 2800heterozygoteCFTR-RD-causing - Cis
    varying clinical consequence - Trans
    CBAVD 1453heterozygoteCFTR-RD-causing - Trans
    non-CF - Trans
    CBAVD 2460heterozygoteCFTR-RD-causing- Undef
    CF-causing- Undef
    Other 980heterozygoteCFTR-RD-causing - Cis
    CF-causing - Trans
    CF 4171heterozygoteCF-causing - Trans
    CF 6312heterozygoteCFTR-RD-causing- Undef
    CF-causing- Undef
    CF 6203heterozygoteCF-causing- Undef
    CF 4831heterozygoteCFTR-RD-causing- Undef
    CF-causing- Undef
    CF 1519heterozygoteCFTR-RD-causing - Cis
    CF-causing - Trans
    CF 1537homozygotec.1210-34_1210-6TG[12]T[5] - Trans
    c.2930C>T - p.(Ser977Phe) - Trans
    Pancreatitis 5326heterozygoteCFTR-RD-causing - Cis
    CF-causing - Trans
    Pancreatitis 6183heterozygoteCFTR-RD-causing - Cis
    CF-causing - Trans
    Pancreatitis 1725heterozygoteCFTR-RD-causing- Undef
    Bronchiectasis 5028homozygotec.1210-34_1210-6TG[12]T[5] - Trans
    c.2930C>T - p.(Ser977Phe) - Trans
    Pending (NBS) 4745heterozygoteCFTR-RD-causing- Undef
    CF-causing- Undef
    Pending (NBS) 5037heterozygoteCFTR-RD-causing- Undef
    CF-causing- Undef
    Asymptomatic compound heterozygote 3012heterozygoteCFTR-RD-causing - Cis
    VUS3 - Trans
    Pending 4746heterozygoteCFTR-RD-causing- Undef
    CF-causing- Undef
    CRS-NP 6313heterozygoteCFTR-RD-causing - Cis
    CF-causing - Trans


    Color code:   non disease-causing <   likely benign <   VUS <   likely pathogenic <   disease-causing



                CFTR variants are clustered into five groups (click here for more details about the classification of variants):
    • CF-causing: when in trans with another CF-causing mutation, will result in CF.
    • CFTR-RD causing: when in trans with a CF-causing mutation, will result in CFTR-related disorders (CFTR-RD) such as chronic pancreatitis, bronchiectasis, CRS-NP (chronic rhinosinusitis with or without nasal polyposis) or CBAVD (congenital absence of vas deferens), according to Bombieri C et al., 2011.
    • Varying clinical consequence: when in trans with another CF-causing mutation, can either result in CF or in a CFTR-RD.
    • Non disease-causing: when in trans with a CF-causing mutation, will not cause CF, nor CFTR-RD.
    • VUS (Variant of unknown clinical significance): unclassified because of insufficient data.



    Go to CFTRare