Variant NM_000492.4:c.2988+1G>A


Variant details:
Name NM_000492.4:c.2988+1G>A
Protein name NP_000483.3:p.(=)
Genomic name (hg19)     chr7:g.117246808G>A    UCSC    
Genomic name (hg38) chr7:g.117606754G>A    UCSC
#Exon/intron intron 18
Legacy Name 3120+1G>A
Class disease-causing
Subclass CF-causing
WT sequence TCTTACCATATTTGACTTCATCCAG G TATGTAAAAATAAGTACCGTTAAGT
Mutant sequence TCTTACCATATTTGACTTCATCCAG A TATGTAAAAATAAGTACCGTTAAGT

Other databases:
dbSNP
rs75096551







Pathogenicity predictors:

Not found




Response to modulators:


Reference PMID Modulator in vitro / ex vivo data clinical data Patient responsiveness
Burgel et al., 2024 39151434 ELX-TEZ-IVAN.D. yesno



1 individuals carrying this variant are reported in CFTR-NGS catalogue


48 patients carrying this variant are reported in CFTR-France:

TOTAL NUMBER OF PATIENTS 48
CF 36
CFTR-RD7
  • Bronchiectasis  2
  • CBAVD  4
  • Pancreatitis  1
Pending 1
Pending (NBS) 4




Color code:   non disease-causing <   likely benign <   VUS <   likely pathogenic <   disease-causing

Detailed genotypes:
Phenotype Patient ID Variant status Additional variants
CF 4557heterozygoteCF-causing - Trans
CF 2624heterozygoteCF-causing- Undef
CF 2604heterozygoteCF-causing - Trans
CF 2563heterozygoteCF-causing - Trans
CF 2552heterozygotevarying clinical consequence- Undef
CF 2498heterozygoteCF-causing- Undef
CF 2075heterozygoteVUS2- Undef
CF 1958heterozygoteCF-causing- Undef
CF 5711heterozygoteCFTR-RD-causing - Trans
CF 3231heterozygotevarying clinical consequence- Undef
CF 6494heterozygoteVUS3- Undef
CF 6493heterozygoteVUS3- Undef
CF 6499heterozygotelikely CFTR-RD- Undef
CF 3886heterozygoteCF-causing- Undef
CF 5328heterozygoteCF-causing- Undef
CF 6224heterozygotevarying clinical consequence- Undef
CF 5878heterozygoteCF-causing - Trans
CF 6490heterozygoteCF-causing- Undef
CF 5529heterozygoteCF-causing - Trans
CF 330heterozygoteCF-causing - Trans
CF 327heterozygoteCF-causing - Trans
CF 177heterozygoteCF-causing- Undef
CF 176heterozygoteCF-causing- Undef
CF 103heterozygoteCF-causing - Trans
CF 102heterozygoteCF-causing - Trans
CF 6512heterozygoteCF-causing- Undef
CF 1919heterozygoteVUS4 - Trans
CF-causing - Trans
CF 5299heterozygoteVUS3- Undef
CF 5100heterozygoteCF-causing- Undef
CF 1826heterozygoteCF-causing- Undef
CF 1815heterozygote
CF 1772heterozygoteCF-causing- Undef
CF 94heterozygoteCF-causing - Trans
CF 790homozygotec.2988+1G>A - p.(=) - Trans
CF 2570homozygotec.2988+1G>A - p.(=) - Trans
CF 101homozygotec.2988+1G>A - p.(=) - Trans
CBAVD 2071heterozygoteCFTR-RD-causing - Trans
CBAVD 2631heterozygoteVUS3- Undef
varying clinical consequence- Undef
CBAVD 1957heterozygoteCFTR-RD-causing- Undef
CBAVD 656heterozygotevarying clinical consequence- Undef
Bronchiectasis 6488heterozygoteVUS3- Undef
Bronchiectasis 5034heterozygoteCFTR-RD-causing- Undef
Pending (NBS) 4354heterozygotevarying clinical consequence - Trans
Pending (NBS) 3919heterozygoteVUS3 - Trans
Pending (NBS) 5609heterozygoteVUS3 - Trans
Pending (NBS) 5372heterozygoteVUS3- Undef
Pancreatitis 2553heterozygote
Pending 5008heterozygotevarying clinical consequence- Undef


Color code:   non disease-causing <   likely benign <   VUS <   likely pathogenic <   disease-causing



            CFTR variants are clustered into five groups (click here for more details about the classification of variants):
  • CF-causing: when in trans with another CF-causing mutation, will result in CF.
  • CFTR-RD causing: when in trans with a CF-causing mutation, will result in CFTR-related disorders (CFTR-RD) such as chronic pancreatitis, bronchiectasis, CRS-NP (chronic rhinosinusitis with or without nasal polyposis) or CBAVD (congenital absence of vas deferens), according to Bombieri C et al., 2011.
  • Varying clinical consequence: when in trans with another CF-causing mutation, can either result in CF or in a CFTR-RD.
  • Non disease-causing: when in trans with a CF-causing mutation, will not cause CF, nor CFTR-RD.
  • VUS (Variant of unknown clinical significance): unclassified because of insufficient data.



Go to CFTRare