Variant NM_000492.4:c.3454G>C


Variant details:
Name NM_000492.4:c.3454G>C
Protein name NP_000483.3:p.(Asp1152His)
Genomic name (hg19) chr7:g.117254753G>C    UCSC    
#Exon/intron exon 21
Legacy Name D1152H
Class disease-causing
Subclass varying clinical consequence
WT sequence GCAGTGGGCTGTAAACTCCAGCATA G ATGTGGATAGCTTGGTAAGTCTTAT
Mutant sequence GCAGTGGGCTGTAAACTCCAGCATA C ATGTGGATAGCTTGGTAAGTCTTAT

Other databases:
dbSNP
rs75541969



Pathogenicity predictors:

Functional studies:


Reference PMID Splicing mRNA level Maturation Localization Channel fonction (Cl-) Bicarbonate
Vankeerberghen et al, 1998 9804160 ✓ ✓
Caputo et al, 2009 19491324 ✓ ✓
Van Goor et al, 2014 23891399 ✓ ✓ ✓
Sosnay et al, 2013 23974870 ✓ ✓
LaRusch et al, 2014 25033378 ✓ ✓ ✓


« ✓ » indicates the type of analysis performed and not the results


Response to modulators:


Modulator FDA approval EMA approval in vitro / ex vivo data clinical data
IVA yesnono yes
TEZ-IVA yes yesno yes
ELX-TEZ-IVA yesnoyesno


clinical and functional data are provided by Vertex


3 individuals carrying this variant are reported in CFTR-NGS catalogue


119 patients carrying this variant are reported in CFTR-France:

TOTAL NUMBER OF PATIENTS 119
Asymptomatic compound heterozygote 4
CF 31
CFTR-RD74
  • Aquagenic palmoplantar keratoderma  1
  • Bronchiectasis  11
  • CBAVD  44
  • CRS-NP  3
  • Other  8
  • Pancreatitis  7
Pending 3
Pending (NBS) 7




Color code:   non disease-causing <   likely benign <   VUS <   likely pathogenic <   disease-causing

Detailed genotypes:
Phenotype Patient ID Variant status Additional variants
CBAVD 2202heterozygoteCF-causing- Undef
CBAVD 1968heterozygoteCF-causing- Undef
CBAVD 1783heterozygoteCF-causing- Undef
CBAVD 5047heterozygotevarying clinical consequence- Undef
CBAVD 5095heterozygoteCF-causing- Undef
CBAVD 5398heterozygoteCF-causing- Undef
CBAVD 5459heterozygotevarying clinical consequence - Trans
CBAVD 4271heterozygoteCF-causing- Undef
CBAVD 4562heterozygoteCF-causing - Trans
CBAVD 4595heterozygoteCFTR-RD-causing- Undef
CBAVD 2713heterozygoteCF-causing- Undef
CBAVD 2747heterozygotevarying clinical consequence- Undef
CBAVD 3281heterozygoteCF-causing- Undef
CBAVD 3309heterozygoteCF-causing- Undef
CBAVD 3311heterozygotevarying clinical consequence- Undef
CBAVD 5593heterozygoteCFTR-RD-causing- Undef
CBAVD 1668heterozygoteCF-causing- Undef
CBAVD 8heterozygoteCF-causing - Trans
CBAVD 492heterozygoteCF-causing- Undef
CBAVD 498heterozygoteCF-causing - Trans
CBAVD 541heterozygoteCF-causing - Trans
CBAVD 544heterozygoteCF-causing- Undef
CBAVD 612heterozygoteCF-causing- Undef
CBAVD 697heterozygoteCFTR-RD-causing - Trans
CFTR-RD-causing - Trans
CFTR-RD-causing - Trans
CBAVD 737heterozygoteCF-causing- Undef
CBAVD 897heterozygoteCF-causing- Undef
CBAVD 990heterozygoteCF-causing- Undef
CBAVD 477heterozygoteCF-causing- Undef
CBAVD 4696heterozygoteCF-causing- Undef
CBAVD 416heterozygoteCF-causing- Undef
CBAVD 418heterozygoteCFTR-RD-causing- Undef
CBAVD 425heterozygoteCF-causing- Undef
CBAVD 437heterozygoteCF-causing - Trans
CBAVD 448heterozygoteCF-causing- Undef
CBAVD 1454heterozygoteCFTR-RD-causing- Undef
CBAVD 1490heterozygoteVUS3 - Trans
VUS1 - Trans
CBAVD 1497heterozygoteCF-causing- Undef
CBAVD 1509heterozygotelikely CFTR-RD- Undef
CBAVD 1521heterozygoteCF-causing - Trans
CBAVD 1616heterozygotevarying clinical consequence- Undef
CBAVD 1401heterozygoteCFTR-RD-causing- Undef
CBAVD 1368heterozygoteCFTR-RD-causing- Undef
CBAVD 1263heterozygoteCF-causing - Trans
CBAVD 1314heterozygoteCF-causing- Undef
Bronchiectasis 2022heterozygoteCF-causing - Trans
Bronchiectasis 5112heterozygoteCF-causing- Undef
Bronchiectasis 5887heterozygoteCF-causing- Undef
Bronchiectasis 4604heterozygoteCF-causing- Undef
Bronchiectasis 4607heterozygoteCF-causing- Undef
Bronchiectasis 3213heterozygoteCF-causing - Trans
CFTR-RD-causing - Trans
Bronchiectasis 4678heterozygoteCF-causing - Trans
Bronchiectasis 5182heterozygoteCF-causing- Undef
VUS3- Undef
Bronchiectasis 1117heterozygoteCF-causing- Undef
Bronchiectasis 4863heterozygoteCF-causing- Undef
Bronchiectasis 5707homozygotec.3454G>C - p.(Asp1152His) - Trans
Pancreatitis 2110heterozygoteCFTR-RD-causing - Trans
Pancreatitis 4890heterozygoteCF-causing- Undef
Pancreatitis 4976heterozygoteCFTR-RD-causing- Undef
Pancreatitis 5698heterozygoteCFTR-RD-causing- Undef
Pancreatitis 4692heterozygoteCFTR-RD-causing- Undef
Pancreatitis 1662heterozygoteCF-causing- Undef
Pancreatitis 5696homozygotec.3454G>C - p.(Asp1152His) - Trans
CRS-NP 4733heterozygoteCF-causing- Undef
CRS-NP 5537heterozygoteCFTR-RD-causing- Undef
CRS-NP 6189heterozygoteCF-causing- Undef
CF 1728heterozygoteCF-causing- Undef
CF 2023heterozygoteCF-causing- Undef
CF 2088heterozygoteCF-causing- Undef
CF 2121heterozygoteCF-causing- Undef
CF 2426heterozygoteCF-causing- Undef
CF 4895heterozygoteCF-causing- Undef
CF 4923heterozygoteCF-causing- Undef
CF 2015heterozygoteCF-causing- Undef
CF 1729heterozygoteCF-causing- Undef
CF 4999heterozygoteCF-causing- Undef
CF 4924heterozygoteCF-causing - Trans
CF 4952heterozygoteCF-causing- Undef
CF 4133heterozygoteCF-causing - Trans
CF 4605heterozygoteCF-causing - Trans
CF 4128heterozygoteCF-causing - Trans
CF 4035heterozygoteCF-causing- Undef
CF 2842heterozygoteCF-causing - Trans
CF 579heterozygoteCF-causing - Trans
CF 600heterozygoteCF-causing- Undef
CF 787heterozygoteCF-causing - Trans
CF 488heterozygoteCF-causing - Trans
CF 238heterozygoteCF-causing - Trans
CF 249heterozygoteCF-causing - Trans
CF 264heterozygoteCF-causing- Undef
CF 1543heterozygoteCF-causing- Undef
CF 1545heterozygoteCF-causing - Trans
CF 1628heterozygoteCF-causing- Undef
CF 1259heterozygoteCF-causing- Undef
CF 1279heterozygoteCF-causing - Trans
CF 4864heterozygoteCF-causing- Undef
CF 1667heterozygoteCF-causing- Undef
Other 2260heterozygoteCF-causing- Undef
Other 5369heterozygoteCF-causing- Undef
Other 4542heterozygoteCF-causing - Trans
Other 4600heterozygoteCF-causing- Undef
Other 6190heterozygoteCF-causing- Undef
Other 315heterozygoteVUS3- Undef
Other 4799heterozygoteCF-causing- Undef
VUS3- Undef
Other 1082heterozygoteCF-causing - Trans
Aquagenic palmoplantar keratoderma 5365heterozygoteVUS3- Undef
VUS3- Undef
Pending (NBS) 4920heterozygoteCF-causing - Trans
Pending (NBS) 6019heterozygoteCF-causing - Trans
Pending (NBS) 3876heterozygoteCF-causing- Undef
Pending (NBS) 3492heterozygoteCF-causing- Undef
Pending (NBS) 5805heterozygoteCF-causing - Trans
Pending (NBS) 1566heterozygoteCF-causing - Trans
Pending (NBS) 1114heterozygoteCF-causing - Trans
Pending 1212heterozygoteCF-causing - Trans
Pending 2132heterozygotevarying clinical consequence - Trans
Pending 2944heterozygoteCF-causing - Trans
Asymptomatic compound heterozygote 4564heterozygoteCF-causing - Trans
Asymptomatic compound heterozygote 2808heterozygoteCFTR-RD-causing- Undef
Asymptomatic compound heterozygote 2971heterozygoteCF-causing - Trans
Asymptomatic compound heterozygote 1574heterozygoteCF-causing - Trans


Color code:   non disease-causing <   likely benign <   VUS <   likely pathogenic <   disease-causing



            CFTR variants are clustered into five groups:
  • CF-causing: when in trans with another CF-causing mutation, will result in CF.
  • CFTR-RD causing: when in trans with a CF-causing mutation, will result in CFTR-related disorders (CFTR-RD) such as chronic pancreatitis, bronchiectasis, CRS-NP (chronic rhinosinusitis with or without nasal polyposis) or CBAVD (congenital absence of vas deferens), according to Bombieri C et al., 2011.
  • Varying clinical consequence: when in trans with another CF-causing mutation, can either result in CF or in a CFTR-RD.
  • Non disease-causing: when in trans with a CF-causing mutation, will not cause CF, nor CFTR-RD.
  • VUS (Variant of unknown clinical significance): unclassified because of insufficient data.



Go to CFTRare