Updates for c.3454G>C:
2024-12-09 Variant classified as varying clinical consequence (low penetrance of CF) on the basis of epidemiological data (in particular high frequency in the general population), the number and type of diagnosis for patients reported in CFTR-France and functional data




Variant NM_000492.4:c.3454G>C


Variant details:
Name NM_000492.4:c.3454G>C
Protein name NP_000483.3:p.(Asp1152His)
Genomic name (hg19)     chr7:g.117254753G>C    UCSC    
Genomic name (hg38) chr7:g.117614699G>C    UCSC
#Exon/intron exon 21
Legacy Name D1152H
Class disease-causing
Subclass varying clinical consequence
WT sequence GCAGTGGGCTGTAAACTCCAGCATA G ATGTGGATAGCTTGGTAAGTCTTAT
Mutant sequence GCAGTGGGCTGTAAACTCCAGCATA C ATGTGGATAGCTTGGTAAGTCTTAT

Other databases:
dbSNP
rs75541969



Pathogenicity predictors:

Functional studies:


Reference PMID Splicing mRNA level Maturation Localization Channel fonction (Cl-) Bicarbonate
Vankeerberghen et al, 1998 9804160 ✓ ✓
Caputo et al, 2009 19491324 ✓ ✓
Van Goor et al, 2014 23891399 ✓ ✓ ✓
Sosnay et al, 2013 23974870 ✓ ✓
LaRusch et al, 2014 25033378 ✓ ✓ ✓


« ✓ » indicates the type of analysis performed and not the results


Response to modulators:


Modulator FDA approval EMA approval in vitro / ex vivo data clinical data
IVA yesnono yes
TEZ-IVA yes yesno yes
ELX-TEZ-IVA yesnoyesno


clinical and functional data are provided by Vertex


3 individuals carrying this variant are reported in CFTR-NGS catalogue


127 patients carrying this variant are reported in CFTR-France:

TOTAL NUMBER OF PATIENTS 127
Asymptomatic compound heterozygote 4
CF 31
CFTR-RD81
  • Aquagenic palmoplantar keratoderma  1
  • Bronchiectasis  13
  • CBAVD  48
  • CRS-NP  3
  • Other  9
  • Pancreatitis  7
Pending 3
Pending (NBS) 8




Color code:   non disease-causing <   likely benign <   VUS <   likely pathogenic <   disease-causing

Detailed genotypes:
Phenotype Patient ID Variant status Additional variants
CBAVD 2202heterozygoteCF-causing- Undef
CBAVD 5047heterozygotevarying clinical consequence- Undef
CBAVD 5095heterozygoteCF-causing- Undef
CBAVD 5398heterozygoteCF-causing- Undef
CBAVD 5459heterozygotevarying clinical consequence - Trans
CBAVD 6245heterozygoteCF-causing- Undef
CBAVD 6394heterozygotevarying clinical consequence- Undef
CBAVD 1968heterozygoteCF-causing- Undef
CBAVD 2713heterozygoteCF-causing- Undef
CBAVD 2747heterozygotevarying clinical consequence- Undef
CBAVD 4562heterozygoteCF-causing - Trans
CBAVD 4595heterozygoteCFTR-RD-causing- Undef
CBAVD 6473heterozygoteVUS3- Undef
CBAVD 6479heterozygoteCF-causing - Trans
CBAVD 4271heterozygoteCF-causing- Undef
CBAVD 3281heterozygoteCF-causing- Undef
CBAVD 3309heterozygoteCF-causing- Undef
CBAVD 3311heterozygotevarying clinical consequence- Undef
CBAVD 5593heterozygoteCFTR-RD-causing- Undef
CBAVD 8heterozygoteCF-causing - Trans
CBAVD 498heterozygoteCF-causing - Trans
CBAVD 541heterozygoteCF-causing - Trans
CBAVD 544heterozygoteCF-causing- Undef
CBAVD 612heterozygoteCF-causing- Undef
CBAVD 697heterozygoteVUS3 - Trans
CBAVD 737heterozygoteCF-causing- Undef
CBAVD 897heterozygoteCF-causing- Undef
CBAVD 990heterozygoteCF-causing- Undef
CBAVD 492heterozygoteCF-causing- Undef
CBAVD 4696heterozygoteCF-causing- Undef
CBAVD 416heterozygoteCF-causing- Undef
CBAVD 418heterozygoteCFTR-RD-causing- Undef
CBAVD 425heterozygoteCF-causing- Undef
CBAVD 437heterozygoteCF-causing - Trans
CBAVD 448heterozygoteCF-causing- Undef
CBAVD 477heterozygoteCF-causing- Undef
CBAVD 1509heterozygotelikely CFTR-RD- Undef
CBAVD 1521heterozygoteCF-causing - Trans
CBAVD 1616heterozygotevarying clinical consequence- Undef
CBAVD 1668heterozygoteCF-causing- Undef
CBAVD 1497heterozygoteCF-causing- Undef
CBAVD 1490heterozygoteVUS3 - Trans
VUS1 - Trans
CBAVD 1263heterozygoteCF-causing - Trans
CBAVD 1314heterozygoteCF-causing- Undef
CBAVD 1368heterozygoteCFTR-RD-causing- Undef
CBAVD 1401heterozygoteCFTR-RD-causing- Undef
CBAVD 1454heterozygoteCFTR-RD-causing- Undef
CBAVD 1783heterozygoteCF-causing- Undef
Bronchiectasis 2022heterozygoteCF-causing - Trans
Bronchiectasis 5112heterozygoteCF-causing- Undef
Bronchiectasis 5887heterozygoteCF-causing- Undef
Bronchiectasis 6244heterozygoteCF-causing - Trans
Bronchiectasis 6273heterozygoteCF-causing - Trans
Bronchiectasis 4604heterozygoteCF-causing- Undef
Bronchiectasis 4607heterozygoteCF-causing- Undef
Bronchiectasis 3213heterozygoteCF-causing - Trans
CFTR-RD-causing - Trans
Bronchiectasis 4678heterozygoteCF-causing - Trans
Bronchiectasis 5182heterozygoteCF-causing- Undef
VUS3- Undef
Bronchiectasis 1117heterozygoteCF-causing- Undef
Bronchiectasis 4863heterozygoteCF-causing- Undef
Bronchiectasis 5707homozygotec.3454G>C - p.(Asp1152His) - Trans
Pancreatitis 2110heterozygoteCFTR-RD-causing - Trans
Pancreatitis 4890heterozygoteCF-causing- Undef
Pancreatitis 5698heterozygoteCFTR-RD-causing- Undef
Pancreatitis 4976heterozygoteCFTR-RD-causing- Undef
Pancreatitis 4692heterozygoteCFTR-RD-causing- Undef
Pancreatitis 1662heterozygoteCF-causing- Undef
Pancreatitis 5696homozygotec.3454G>C - p.(Asp1152His) - Trans
CRS-NP 4733heterozygoteCF-causing- Undef
CRS-NP 5537heterozygoteCFTR-RD-causing- Undef
CRS-NP 6189heterozygoteCF-causing- Undef
CF 4999heterozygoteCF-causing- Undef
CF 2088heterozygoteCF-causing- Undef
CF 2121heterozygoteCF-causing- Undef
CF 2426heterozygoteCF-causing- Undef
CF 4895heterozygoteCF-causing- Undef
CF 4923heterozygoteCF-causing- Undef
CF 4924heterozygoteCF-causing - Trans
CF 4952heterozygoteCF-causing- Undef
CF 2023heterozygoteCF-causing- Undef
CF 2015heterozygoteCF-causing- Undef
CF 4605heterozygoteCF-causing - Trans
CF 4133heterozygoteCF-causing - Trans
CF 2842heterozygoteCF-causing - Trans
CF 4035heterozygoteCF-causing- Undef
CF 4128heterozygoteCF-causing - Trans
CF 579heterozygoteCF-causing - Trans
CF 600heterozygoteCF-causing- Undef
CF 787heterozygoteCF-causing - Trans
CF 488heterozygoteCF-causing - Trans
CF 238heterozygoteCF-causing - Trans
CF 249heterozygoteCF-causing - Trans
CF 264heterozygoteCF-causing- Undef
CF 1543heterozygoteCF-causing- Undef
CF 1545heterozygoteCF-causing - Trans
CF 1628heterozygoteCF-causing- Undef
CF 1667heterozygoteCF-causing- Undef
CF 1728heterozygoteCF-causing- Undef
CF 1729heterozygoteCF-causing- Undef
CF 1259heterozygoteCF-causing- Undef
CF 1279heterozygoteCF-causing - Trans
CF 4864heterozygoteCF-causing- Undef
Other 2260heterozygoteCF-causing- Undef
Other 5369heterozygoteCF-causing- Undef
Other 4542heterozygoteCF-causing - Trans
Other 4600heterozygoteCF-causing- Undef
Other 6190heterozygoteCF-causing- Undef
Other 6310heterozygoteCF-causing- Undef
Other 315heterozygoteVUS3- Undef
Other 4799heterozygoteCF-causing- Undef
VUS3- Undef
Other 1082heterozygoteCF-causing - Trans
Aquagenic palmoplantar keratoderma 5365heterozygoteVUS3- Undef
VUS3- Undef
Pending (NBS) 4920heterozygoteCF-causing - Trans
Pending (NBS) 6019heterozygoteCF-causing - Trans
Pending (NBS) 6482heterozygoteCF-causing- Undef
Pending (NBS) 3492heterozygoteCF-causing- Undef
Pending (NBS) 3876heterozygoteCF-causing- Undef
Pending (NBS) 5805heterozygoteCF-causing - Trans
Pending (NBS) 1566heterozygoteCF-causing - Trans
Pending (NBS) 1114heterozygoteCF-causing - Trans
Pending 1212heterozygoteCF-causing - Trans
Pending 2132heterozygotevarying clinical consequence - Trans
Pending 2944heterozygoteCF-causing - Trans
Asymptomatic compound heterozygote 4564heterozygoteCF-causing - Trans
Asymptomatic compound heterozygote 2808heterozygote
Asymptomatic compound heterozygote 2971heterozygoteCF-causing - Trans
Asymptomatic compound heterozygote 1574heterozygoteCF-causing - Trans


Color code:   non disease-causing <   likely benign <   VUS <   likely pathogenic <   disease-causing



            CFTR variants are clustered into five groups:
  • CF-causing: when in trans with another CF-causing mutation, will result in CF.
  • CFTR-RD causing: when in trans with a CF-causing mutation, will result in CFTR-related disorders (CFTR-RD) such as chronic pancreatitis, bronchiectasis, CRS-NP (chronic rhinosinusitis with or without nasal polyposis) or CBAVD (congenital absence of vas deferens), according to Bombieri C et al., 2011.
  • Varying clinical consequence: when in trans with another CF-causing mutation, can either result in CF or in a CFTR-RD.
  • Non disease-causing: when in trans with a CF-causing mutation, will not cause CF, nor CFTR-RD.
  • VUS (Variant of unknown clinical significance): unclassified because of insufficient data.



Go to CFTRare