Variant NM_000492.4:c.3718-2477C>T


Variant details:
Name NM_000492.4:c.3718-2477C>T
Protein name NP_000483.3:p.(=)
Genomic name (hg19) chr7:g.117280015C>T    UCSC    
#Exon/intron intron 22
Legacy Name 3849+10kbC>T
Class disease-causing
Subclass varying clinical consequence
WT sequence TCCATCTGTTGCAGTATTAAAATGG C GAGTAAGACACCCTGAAAGGAAATG
Mutant sequence TCCATCTGTTGCAGTATTAAAATGG T GAGTAAGACACCCTGAAAGGAAATG

Other databases:
dbSNP
rs75039782







Pathogenicity predictors:

Not found



Response to modulators:


Modulator FDA approval EMA approval in vitro / ex vivo data clinical data
IVA yesnono yes
TEZ-IVA yes yesno yes
ELX-TEZ-IVAnononono


clinical and functional data are provided by Vertex


1 individuals carrying this variant are reported in CFTR-NGS catalogue


70 patients carrying this variant are reported in CFTR-France:

TOTAL NUMBER OF PATIENTS 70
Asymptomatic compound heterozygote 4
CF 43
CFTR-RD16
  • Bronchiectasis  8
  • CBAVD  2
  • CRS-NP  1
  • Other  3
  • Pancreatitis  2
Pending 1
Pending (NBS) 5
Pending non-CF 1




Color code:   non disease-causing <   likely benign <   VUS <   likely pathogenic <   disease-causing

Detailed genotypes:
Phenotype Patient ID Variant status Additional variants
CBAVD 1332heterozygoteCF-causing- Undef
CBAVD 57heterozygoteCFTR-RD-causing - Trans
CF 2796heterozygoteCF-causing - Trans
CF 2760heterozygoteCF-causing - Trans
CF 2717heterozygoteCF-causing - Trans
CF 2654heterozygoteCF-causing- Undef
CF 2554heterozygoteCF-causing- Undef
CF 2496heterozygoteCF-causing- Undef
CF 2323heterozygoteCF-causing- Undef
CF 2175heterozygoteCF-causing- Undef
CF 2059heterozygoteCF-causing- Undef
CF 5042heterozygoteCF-causing- Undef
CF 2861heterozygoteCF-causing - Trans
CF 2879heterozygoteCF-causing - Trans
CF 4340heterozygoteCF-causing - Trans
CF 4339heterozygoteCF-causing - Trans
CF 4332heterozygoteCF-causing - Trans
CF 3816heterozygotevarying clinical consequence - Trans
CF 3745heterozygoteCF-causing - Trans
CF 3625heterozygoteCF-causing- Undef
CF 5965heterozygoteCF-causing- Undef
CF 3228heterozygoteCF-causing - Trans
CF 1771heterozygoteCF-causing- Undef
CF 1768heterozygoteCF-causing- Undef
CF 369heterozygoteCF-causing- Undef
CF 333heterozygoteCF-causing - Trans
CF 233heterozygoteCF-causing - Trans
CF 232heterozygoteCF-causing - Trans
CF 228heterozygoteCF-causing - Trans
CF 227heterozygoteCF-causing - Trans
CF 219heterozygoteCF-causing- Undef
CF 214heterozygoteCF-causing- Undef
CF 197heterozygoteCF-causing- Undef
CF 169heterozygoteCF-causing - Trans
CF 159heterozygoteCF-causing - Trans
CF 111heterozygoteCF-causing - Trans
CF 73heterozygoteCF-causing - Trans
CF 59heterozygoteCF-causing- Undef
CF 783heterozygoteCF-causing - Trans
CF 813heterozygoteCF-causing - Trans
CF 911heterozygoteCF-causing - Trans
CF 1002heterozygoteCF-causing - Trans
CF 3823homozygotec.3718-2477C>T - p.(=) - Trans
CF 1169homozygotec.3718-2477C>T - p.(=) - Trans
CF 362homozygotec.3718-2477C>T - p.(=) - Trans
Pancreatitis 5368heterozygoteCFTR-RD-causing- Undef
Pancreatitis 70heterozygoteCF-causing - Trans
Pending (NBS) 5106heterozygoteCF-causing - Trans
Pending (NBS) 4202heterozygoteCF-causing- Undef
Pending (NBS) 5349heterozygoteCF-causing- Undef
Pending (NBS) 377heterozygoteCF-causing - Trans
Pending (NBS) 5088heterozygoteCF-causing- Undef
Asymptomatic compound heterozygote 5167heterozygote
Asymptomatic compound heterozygote 577heterozygotelikely CFTR-RD - Trans
Asymptomatic compound heterozygote 5242heterozygotevarying clinical consequence- Undef
Asymptomatic compound heterozygote 639heterozygoteCFTR-RD-causing - Trans
Bronchiectasis 2677heterozygoteCF-causing- Undef
Bronchiectasis 1868heterozygoteCF-causing - Trans
Bronchiectasis 4321heterozygoteCF-causing- Undef
Bronchiectasis 1088heterozygoteCF-causing - Trans
Bronchiectasis 1078heterozygoteCF-causing- Undef
Bronchiectasis 5826heterozygoteCF-causing- Undef
Bronchiectasis 5824heterozygoteCF-causing- Undef
Bronchiectasis 5895homozygotec.3718-2477C>T - p.(=) - Trans
Other 4315heterozygote
Other 3054heterozygote
Other 1741heterozygoteCF-causing- Undef
Pending 2132heterozygotevarying clinical consequence - Trans
Pending non-CF 3094heterozygoteCFTR-RD-causing - Trans
CRS-NP 4384heterozygoteCF-causing - Trans


Color code:   non disease-causing <   likely benign <   VUS <   likely pathogenic <   disease-causing



            CFTR variants are clustered into five groups:
  • CF-causing: when in trans with another CF-causing mutation, will result in CF.
  • CFTR-RD causing: when in trans with a CF-causing mutation, will result in CFTR-related disorders (CFTR-RD) such as chronic pancreatitis, bronchiectasis, CRS-NP (chronic rhinosinusitis with or without nasal polyposis) or CBAVD (congenital absence of vas deferens), according to Bombieri C et al., 2011.
  • Varying clinical consequence: when in trans with another CF-causing mutation, can either result in CF or in a CFTR-RD.
  • Non disease-causing: when in trans with a CF-causing mutation, will not cause CF, nor CFTR-RD.
  • VUS (Variant of unknown clinical significance): unclassified because of insufficient data.



Go to CFTRare