Variant NM_000492.4:c.3909C>G


Variant details:
Name NM_000492.4:c.3909C>G
Protein name NP_000483.3:p.(Asn1303Lys)
Genomic name (hg19) chr7:g.117292931C>G    UCSC    
#Exon/intron exon 24
Legacy Name N1303K
Class disease-causing
Subclass CF-causing
WT sequence TTTTTTCTGGAACATTTAGAAAAAA C TTGGATCCCTATGAACAGTGGAGTG
Mutant sequence TTTTTTCTGGAACATTTAGAAAAAA G TTGGATCCCTATGAACAGTGGAGTG

Other databases:
dbSNP
rs80034486



Pathogenicity predictors:


Reference PMID Splicing mRNA level Maturation Localization Channel fonction (Cl-) Bicarbonate
Gregory et al, 1991 1712898
Van Goor et al, 2014 23891399
Sosnay et al, 2013 23974870


« ✓ » indicates the type of analysis performed and not the results




3 individuals carrying this variant are reported in CFTR-NGS catalogue


185 patients carrying this variant are reported in CFTR-France:

TOTAL NUMBER OF PATIENTS 185
Asymptomatic compound heterozygote 6
CF 125
CFTR-RD39
  • Bronchiectasis  4
  • CBAVD  23
  • Other  5
  • Pancreatitis  7
Fetal bowel anomalies 5
Pending (NBS) 10




Color code:   non disease-causing <   likely benign <   VUS <   likely pathogenic <   disease-causing

Detailed genotypes:
Phenotype Patient ID Variant status Additional variants
CF 3077heterozygoteCF-causing- Undef
CF 2739heterozygoteCF-causing - Trans
CF 2675heterozygoteVUS1- Undef
CF-causing- Undef
CF 2666heterozygoteCF-causing- Undef
CF 2639heterozygoteCF-causing- Undef
CF 4925heterozygoteCF-causing - Trans
CF 2754heterozygoteCF-causing - Trans
CF 2760heterozygotevarying clinical consequence - Trans
CF 4633heterozygoteCF-causing- Undef
CF 2957heterozygoteCF-causing- Undef
CF 2921heterozygoteCF-causing - Trans
CF 2898heterozygoteCF-causing - Trans
VUS3- Undef
CF 2818heterozygoteCF-causing - Trans
CF 2775heterozygoteCF-causing- Undef
CF 2266heterozygoteCF-causing- Undef
CF 1999heterozygoteVUS1- Undef
CF-causing- Undef
CF 1995heterozygoteCF-causing- Undef
CF 1934heterozygoteCF-causing- Undef
CF 6246heterozygoteVUS3- Undef
CFTR-RD-causing- Undef
CF 2560heterozygoteCF-causing- Undef
CF 2550heterozygoteCF-causing- Undef
CF 2518heterozygoteCF-causing- Undef
CF 2515heterozygoteCF-causing- Undef
CF 2482heterozygoteCF-causing- Undef
CF 2480heterozygoteCF-causing- Undef
CF 2385heterozygoteCF-causing- Undef
CF 4181heterozygoteCF-causing - Trans
CF 4172heterozygoteCF-causing- Undef
CF 4114heterozygoteCF-causing - Trans
CF 4101heterozygoteCF-causing- Undef
CF 3921heterozygoteCF-causing- Undef
CF 4329heterozygoteCF-causing - Trans
CF 4390heterozygotevarying clinical consequence - Trans
CF 6174heterozygoteCF-causing - Trans
CF 6087heterozygoteCF-causing- Undef
CF 4476heterozygoteCF-causing - Trans
CF 4443heterozygoteCF-causing - Trans
CF 3862heterozygotevarying clinical consequence- Undef
CF 3828heterozygoteCF-causing- Undef
CF 3635heterozygoteCF-causing - Trans
CF 3302heterozygoteCF-causing - Trans
CF 3282heterozygoteCF-causing- Undef
CF 3260heterozygoteCF-causing - Trans
CF 3256heterozygoteCF-causing - Trans
CF 3218heterozygoteCF-causing- Undef
CF 3179heterozygoteCF-causing - Trans
CF 3122heterozygoteCF-causing - Trans
CF 3308heterozygoteCF-causing - Trans
CF 3546heterozygoteCF-causing - Trans
CF 3461heterozygoteCF-causing - Trans
CF 3441heterozygoteCF-causing - Trans
CF 3435heterozygoteCF-causing- Undef
CF 3385heterozygoteCF-causing - Trans
CF 5016heterozygotevarying clinical consequence- Undef
CF 1010heterozygoteCF-causing - Trans
CF 715heterozygoteCF-causing - Trans
CF 657heterozygoteCF-causing - Trans
CF 586heterozygoteCF-causing- Undef
CF 582heterozygotevarying clinical consequence- Undef
CF 383heterozygotevarying clinical consequence - Trans
CF-causing - Trans
CF 723heterozygoteCF-causing - Trans
CF 1008heterozygoteCF-causing - Trans
CF 906heterozygoteCF-causing - Trans
CF 872heterozygoteCF-causing - Trans
CF 869heterozygoteCF-causing - Trans
CF 843heterozygoteCF-causing - Trans
CF 808heterozygotevarying clinical consequence - Trans
CF 344heterozygoteCF-causing - Trans
CF 128heterozygotevarying clinical consequence - Trans
CF 120heterozygoteCF-causing - Trans
CF 64heterozygoteCF-causing- Undef
CF 46heterozygoteCF-causing - Trans
CF 37heterozygoteCF-causing - Trans
CF 16heterozygoteCF-causing- Undef
CF 130heterozygoteCF-causing - Trans
CF 139heterozygotelikely CF - Trans
CF 343heterozygoteCF-causing - Trans
CF 3heterozygoteCF-causing - Trans
CF 251heterozygoteCF-causing - Trans
CF 224heterozygoteCF-causing - Trans
CF 212heterozygoteCF-causing - Trans
CF 199heterozygoteCF-causing- Undef
CF 185heterozygoteCF-causing - Trans
CF 140heterozygoteCF-causing - Trans
CF 14heterozygoteCF-causing - Trans
CF 1918heterozygoteCF-causing- Undef
CF 1782heterozygoteCF-causing- Undef
CF 1642heterozygoteCF-causing- Undef
CF 1614heterozygoteCF-causing- Undef
CF 1834heterozygoteCF-causing- Undef
CF 1612heterozygoteCF-causing- Undef
CF 5438heterozygotevarying clinical consequence - Trans
CF 1558heterozygoteCF-causing- Undef
CF 4990heterozygoteCF-causing - Trans
CF 1916heterozygoteCF-causing- Undef
CF 1873heterozygoteCF-causing- Undef
CF 1861heterozygoteCF-causing- Undef
CF 5110heterozygoteCF-causing - Trans
CF 5055heterozygoteCF-causing- Undef
CF 4992heterozygoteCF-causing - Trans
CF 4991heterozygoteCF-causing - Trans
CF 1519heterozygoteCFTR-RD-causing - Trans
varying clinical consequence - Trans
CF 1165heterozygoteCF-causing - Trans
CF 1159heterozygoteCF-causing - Trans
CF 1131heterozygoteCF-causing - Trans
CF 1081heterozygoteCF-causing - Trans
CF 1050heterozygoteCF-causing- Undef
CF 1014heterozygoteCF-causing - Trans
CF 6354heterozygoteCF-causing- Undef
CF 5811heterozygoteCF-causing- Undef
CF 1206heterozygoteCF-causing - Trans
CF 1211heterozygoteCF-causing- Undef
CF 1235heterozygoteCF-causing - Trans
CF 1297heterozygoteCF-causing- Undef
CF 1320heterozygoteCF-causing- Undef
CF 1747homozygotec.3909C>G - p.(Asn1303Lys) - Trans
CF 930homozygotec.3909C>G - p.(Asn1303Lys) - Trans
CF 275homozygotec.3909C>G - p.(Asn1303Lys) - Trans
CF 269homozygotec.3909C>G - p.(Asn1303Lys) - Trans
CF 4512homozygotec.3909C>G - p.(Asn1303Lys) - Trans
CF 2195homozygotec.3909C>G - p.(Asn1303Lys) - Trans
CF 127homozygotec.3909C>G - p.(Asn1303Lys) - Trans
CF 2509homozygotec.3909C>G - p.(Asn1303Lys) - Trans
CF 1705homozygotec.3909C>G - p.(Asn1303Lys) - Trans
CF 3901homozygotec.3909C>G - p.(Asn1303Lys) - Trans
Other 2641heterozygoteCFTR-RD-causing- Undef
VUS3- Undef
Other 2277heterozygote
Other 4705heterozygoteCF-causing - Trans
Other 27heterozygoteCFTR-RD-causing - Trans
Other 5083heterozygoteVUS3- Undef
Bronchiectasis 4300heterozygote
Bronchiectasis 4234heterozygoteCFTR-RD-causing - Trans
Bronchiectasis 4684heterozygoteVUS3- Undef
Bronchiectasis 4868heterozygotevarying clinical consequence- Undef
varying clinical consequence- Undef
Fetal bowel anomalies 367heterozygoteCF-causing - Trans
Fetal bowel anomalies 607heterozygoteCFTR-RD-causing - Trans
CF-causing - Trans
Fetal bowel anomalies 2535heterozygote
Fetal bowel anomalies 3403heterozygoteCF-causing - Trans
Fetal bowel anomalies 5162heterozygoteCF-causing - Trans
CBAVD 2689heterozygoteCFTR-RD-causing- Undef
CBAVD 2653heterozygoteCFTR-RD-causing- Undef
CBAVD 4905heterozygoteCFTR-RD-causing- Undef
CBAVD 4897heterozygoteVUS3- Undef
CBAVD 4880heterozygoteVUS3- Undef
CBAVD 6392heterozygotevarying clinical consequence- Undef
CBAVD 2348heterozygotevarying clinical consequence- Undef
CBAVD 2549heterozygote
CBAVD 6222heterozygoteVUS3 - Trans
CBAVD 4814heterozygote
CBAVD 3274heterozygoteCFTR-RD-causing- Undef
CBAVD 3343heterozygoteCFTR-RD-causing- Undef
CBAVD 500heterozygotenon-CF- Undef
CBAVD 475heterozygoteCFTR-RD-causing- Undef
non-CF- Undef
CBAVD 407heterozygoteCFTR-RD-causing - Trans
CBAVD 852heterozygoteCFTR-RD-causing- Undef
CBAVD 841heterozygoteCFTR-RD-causing- Undef
CBAVD 1627heterozygotevarying clinical consequence- Undef
CBAVD 1833heterozygote
CBAVD 1455heterozygoteCFTR-RD-causing- Undef
CBAVD 1431heterozygotevarying clinical consequence- Undef
CBAVD 5265heterozygoteCFTR-RD-causing- Undef
CBAVD 1388heterozygoteCFTR-RD-causing- Undef
Pending (NBS) 6031heterozygotevarying clinical consequence- Undef
Pending (NBS) 4243heterozygotelikely CFTR-RD - Trans
Pending (NBS) 6185heterozygotevarying clinical consequence - Trans
Pending (NBS) 6084heterozygoteCFTR-RD-causing- Undef
Pending (NBS) 4606heterozygoteCFTR-RD-causing - Trans
Pending (NBS) 5703heterozygoteVUS3 - Trans
VUS3 - Trans
Pending (NBS) 793heterozygoteVUS3 - Trans
Pending (NBS) 799heterozygotevarying clinical consequence - Trans
Pending (NBS) 5853heterozygoteVUS3 - Trans
Pending (NBS) 1255heterozygotevarying clinical consequence - Trans
Pancreatitis 3072heterozygote
Pancreatitis 4891heterozygoteCFTR-RD-causing- Undef
Pancreatitis 2286heterozygote
Pancreatitis 1960heterozygotevarying clinical consequence- Undef
Pancreatitis 6117heterozygoteVUS1 - Trans
Pancreatitis 3245heterozygoteCFTR-RD-causing - Trans
Pancreatitis 4977heterozygoteCFTR-RD-causing- Undef
Asymptomatic compound heterozygote 2966heterozygote
Asymptomatic compound heterozygote 2798heterozygote
Asymptomatic compound heterozygote 2383heterozygoteCFTR-RD-causing- Undef
Asymptomatic compound heterozygote 6195heterozygotevarying clinical consequence- Undef
Asymptomatic compound heterozygote 5161heterozygoteCFTR-RD-causing - Trans
Asymptomatic compound heterozygote 5606heterozygoteCFTR-RD-causing - Trans
non-CF - Trans


Color code:   non disease-causing <   likely benign <   VUS <   likely pathogenic <   disease-causing



            CFTR variants are clustered into five groups:
  • CF-causing: when in trans with another CF-causing mutation, will result in CF.
  • CFTR-RD causing: when in trans with a CF-causing mutation, will result in CFTR-related disorders (CFTR-RD) such as chronic pancreatitis, bronchiectasis, CRS-NP (chronic rhinosinusitis with or without nasal polyposis) or CBAVD (congenital absence of vas deferens), according to Bombieri C et al., 2011.
  • Varying clinical consequence: when in trans with another CF-causing mutation, can either result in CF or in a CFTR-RD.
  • Non disease-causing: when in trans with a CF-causing mutation, will not cause CF, nor CFTR-RD.
  • VUS (Variant of unknown clinical significance): unclassified because of insufficient data.



Go to CFTRare