Variant NM_000492.4:c.579+1G>T


Variant details:
Name NM_000492.4:c.579+1G>T
Protein name NP_000483.3:p.(=)
Genomic name (hg19)     chr7:g.117174420G>T    UCSC    
Genomic name (hg38) chr7:g.117534366G>T    UCSC
#Exon/intron intron 5
Legacy Name 711+1G>T
Class disease-causing
Subclass CF-causing
WT sequence CAACAACCTGAACAAATTTGATGAA G TATGTACCTATTGATTTAATCTTTT
Mutant sequence CAACAACCTGAACAAATTTGATGAA T TATGTACCTATTGATTTAATCTTTT

Other databases:
dbSNP
rs77188391







Pathogenicity predictors:

Not found





No patient found in CFTR-NGS catalogue


53 patients carrying this variant are reported in CFTR-France:

TOTAL NUMBER OF PATIENTS 53
CF 31
CFTR-RD17
  • Bronchiectasis  3
  • CBAVD  7
  • Other  3
  • Pancreatitis  4
Fetal bowel anomalies 1
Pending 1
Pending (NBS) 1
Pending non-CF 2




Color code:   non disease-causing <   likely benign <   VUS <   likely pathogenic <   disease-causing

Detailed genotypes:
Phenotype Patient ID Variant status Additional variants
CF 2076heterozygoteCF-causing- Undef
CF 1776heterozygoteVUS3 - Trans
CF 1737heterozygoteCF-causing- Undef
CF 1556heterozygoteCF-causing - Trans
CF 4933heterozygotelikely CF- Undef
CF 5710heterozygotelikely CF - Trans
CF 3549heterozygoteCF-causing- Undef
CF 4661heterozygoteCF-causing - Trans
CF 5715heterozygoteCF-causing - Trans
CF 1299heterozygoteCF-causing- Undef
CF 1241heterozygoteCF-causing- Undef
CF 1192heterozygoteCF-causing - Trans
CF 386heterozygoteCF-causing - Trans
CF 180heterozygotevarying clinical consequence - Trans
CF 164heterozygoteCF-causing - Trans
CF 163heterozygoteCF-causing - Trans
CF 162heterozygoteCF-causing - Trans
CF 161heterozygoteCF-causing - Trans
CF 113heterozygoteCF-causing - Trans
CF 23heterozygoteCF-causing - Trans
CF 567heterozygoteCF-causing - Trans
CF 4790heterozygoteCFTR-RD-causing- Undef
CF 5526heterozygoteCF-causing - Trans
CF 994heterozygoteCF-causing - Trans
CF 976heterozygoteCF-causing- Undef
CF 886heterozygoteCF-causing- Undef
CF 844heterozygoteCF-causing- Undef
CF 718heterozygoteCF-causing - Trans
CF 11heterozygoteCF-causing - Trans
CF 999homozygotec.579+1G>T - p.(=) - Trans
CF 286homozygotec.579+1G>T - p.(=) - Trans
Other 5075heterozygoteVUS3 - Trans
Other 4731heterozygoteCFTR-RD-causing- Undef
Other 4783heterozygotevarying clinical consequence - Trans
CBAVD 4875heterozygoteCFTR-RD-causing- Undef
CBAVD 2222heterozygotevarying clinical consequence- Undef
CBAVD 5866heterozygoteVUS3- Undef
CBAVD 4536heterozygote
CBAVD 2776heterozygoteCFTR-RD-causing- Undef
CBAVD 445heterozygoteCFTR-RD-causing- Undef
CBAVD 513heterozygoteCFTR-RD-causing - Trans
Fetal bowel anomalies 677heterozygoteCF-causing - Trans
Pancreatitis 2346heterozygoteCFTR-RD-causing- Undef
Pancreatitis 2137heterozygoteVUS3- Undef
Pancreatitis 1524heterozygoteCFTR-RD-causing - Trans
Pancreatitis 4565heterozygote
Bronchiectasis 6192heterozygote
Bronchiectasis 1985heterozygoteCFTR-RD-causing- Undef
Bronchiectasis 4668heterozygoteVUS3 - Trans
Pending non-CF 5021heterozygoteCFTR-RD-causing - Trans
Pending non-CF 4632heterozygoteCFTR-RD-causing - Trans
Pending (NBS) 4745heterozygoteCFTR-RD-causing- Undef
varying clinical consequence- Undef
Pending 4746heterozygoteCFTR-RD-causing- Undef
varying clinical consequence- Undef


Color code:   non disease-causing <   likely benign <   VUS <   likely pathogenic <   disease-causing



            CFTR variants are clustered into five groups:
  • CF-causing: when in trans with another CF-causing mutation, will result in CF.
  • CFTR-RD causing: when in trans with a CF-causing mutation, will result in CFTR-related disorders (CFTR-RD) such as chronic pancreatitis, bronchiectasis, CRS-NP (chronic rhinosinusitis with or without nasal polyposis) or CBAVD (congenital absence of vas deferens), according to Bombieri C et al., 2011.
  • Varying clinical consequence: when in trans with another CF-causing mutation, can either result in CF or in a CFTR-RD.
  • Non disease-causing: when in trans with a CF-causing mutation, will not cause CF, nor CFTR-RD.
  • VUS (Variant of unknown clinical significance): unclassified because of insufficient data.



Go to CFTRare