Variant NM_000492.4:c.3469-65C>A


Variant details:
Name NM_000492.4:c.3469-65C>A
Protein name NP_000483.3:p.(=)
Genomic name (hg19) chr7:g.117267511C>A    UCSC    
#Exon/intron intron 21
Legacy Name 3601-65C/A
Class non disease-causing
WT sequence ATTTTACAAGTTATTTTTTAGGAAG C ATCAAACTAATTGTGAAATTGTCTG
Mutant sequence ATTTTACAAGTTATTTTTTAGGAAG A ATCAAACTAATTGTGAAATTGTCTG

Other databases:

Not found		dbSNP
rs213989







Pathogenicity predictors:

Not found





55 individuals carrying this variant are reported in CFTR-NGS catalogue


116 patients carrying this variant are reported in CFTR-France:

TOTAL NUMBER OF PATIENTS 116
Asymptomatic compound heterozygote 2
CF 40
CFTR-RD65
  • Aquagenic palmoplantar keratoderma  1
  • Bronchiectasis  4
  • CBAVD  46
  • CRS-NP  2
  • Other  11
  • Pancreatitis  1
Pending (NBS) 9




Color code:   non disease-causing <   likely benign <   VUS <   likely pathogenic <   disease-causing

Detailed genotypes:
Phenotype Patient ID Variant status Additional variants
CF 909heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 4780heterozygoteCF-causing- Undef
CF-causing- Undef
CF 4782heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 4785heterozygotevarying clinical consequence- Undef
CF-causing- Undef
CF 5807heterozygoteCF-causing- Undef
VUS3- Undef
CF 920heterozygoteVUS2- Undef
CF-causing- Undef
CF-causing- Undef
CF 945heterozygoteCF-causing- Undef
CF-causing- Undef
CF 947heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 952heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 4796heterozygoteCF-causing - Cis
CF-causing - Trans
VUS3- Undef
VUS3- Undef
varying clinical consequence- Undef
CF 1536heterozygoteCF-causing- Undef
CF-causing- Undef
CF 1538heterozygoteCF-causing- Undef
CF-causing- Undef
CF 1539heterozygoteCF-causing- Undef
CF 1551heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 1557heterozygoteCF-causing- Undef
CF-causing- Undef
CF 1559heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CF-causing- Undef
CF 1561heterozygoteCF-causing- Undef
CF-causing- Undef
CF 1581heterozygoteCF-causing- Undef
CF-causing- Undef
CF 1584heterozygoteCF-causing- Undef
CF-causing- Undef
CF 1535heterozygoteCF-causing - Cis
CFTR-RD-causing - Cis
CF-causing - Trans
CF 1528heterozygote
CF 1232heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 1262heterozygoteCF-causing- Undef
CF-causing- Undef
CF 1293heterozygotevarying clinical consequence- Undef
CF-causing- Undef
CF 4665heterozygoteVUS3- Undef
CFTR-RD-causing- Undef
CF 662heterozygoteVUS2- Undef
CF-causing- Undef
varying clinical consequence- Undef
CF 663heterozygoteVUS2- Undef
CF-causing- Undef
varying clinical consequence- Undef
CF 738heterozygoteCF-causing- Undef
CF-causing- Undef
CF 316heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 570heterozygotevarying clinical consequence- Undef
CF-causing- Undef
CF 654heterozygoteCF-causing- Undef
CF-causing- Undef
CF 745heterozygoteCF-causing- Undef
CF-causing- Undef
CF 816heterozygoteCF-causing- Undef
CF-causing- Undef
CF 829heterozygoteCF-causing- Undef
varying clinical consequence- Undef
VUS3- Undef
CF 808heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 4688homozygotec.1519_1521del - p.(Ile507del) - Trans
c.2657+5G>A - p.(=) - Trans
CF 882homozygotec.1518C>G - p.(Ile506Met) - Trans
c.1521_1523del - p.(Phe508del) - Trans
CF 730homozygotec.3131A>G - p.(Glu1044Gly) - Trans
CF 5188homozygotec.1792A>T - p.(Lys598*) - Trans
CF 901homozygotec.2657+5G>A - p.(=) - Trans
Other 5823heterozygoteVUS3- Undef
CF-causing- Undef
non-CF- Undef
VUS3- Undef
Other 5825heterozygoteVUS3- Undef
CF-causing- Undef
Other 4783heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Other 935heterozygoteCFTR-RD-causing- Undef
Other 940heterozygoteCF-causing- Undef
Other 972heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
Other 4800heterozygoteVUS3- Undef
CF-causing- Undef
VUS3- Undef
varying clinical consequence- Undef
Other 1576heterozygoteCF-causing- Undef
VUS1- Undef
Other 5184heterozygoteVUS3- Undef
CF-causing- Undef
VUS3- Undef
varying clinical consequence- Undef
Other 4671heterozygoteVUS3- Undef
CFTR-RD-causing- Undef
Other 4686heterozygoteVUS3- Undef
CF-causing- Undef
CBAVD 5821heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 986heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 912heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 941heterozygoteVUS4- Undef
CF-causing- Undef
CBAVD 949heterozygoteVUS3- Undef
CF-causing- Undef
CBAVD 978heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 5181heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CFTR-RD-causing- Undef
VUS3- Undef
CBAVD 1248heterozygoteCFTR-RD-causing- Undef
CFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 1276heterozygoteVUS3- Undef
CFTR-RD-causing- Undef
CBAVD 1281heterozygotevarying clinical consequence - Cis
varying clinical consequence - Trans
CBAVD 900heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 664heterozygote
CBAVD 665heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 676heterozygoteVUS3- Undef
CBAVD 682heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 690heterozygote
CBAVD 710heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 720heterozygoteCFTR-RD-causing- Undef
CBAVD 735heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 659heterozygoteCFTR-RD-causing- Undef
CFTR-RD-causing- Undef
VUS3- Undef
CBAVD 658heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 4679heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 4683heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 423heterozygoteVUS3- Undef
CBAVD 643heterozygoteCFTR-RD-causing- Undef
varying clinical consequence- Undef
CBAVD 653heterozygoteCFTR-RD-causing- Undef
varying clinical consequence- Undef
varying clinical consequence- Undef
CBAVD 656heterozygotevarying clinical consequence- Undef
CF-causing- Undef
CBAVD 743heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 812heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 818heterozygote
CBAVD 834heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 840heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 856heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 857heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 858heterozygote
CBAVD 887heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 892heterozygoteCFTR-RD-causing- Undef
varying clinical consequence- Undef
CFTR-RD-causing- Undef
CFTR-RD-causing- Undef
CBAVD 805heterozygoteVUS1- Undef
CBAVD 781heterozygoteVUS3- Undef
CBAVD 765heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 763heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 908homozygotec.1210-34_1210-6TG[11]T[5] - Trans
c.1466C>T - p.(Ser489Leu) - Trans
c.1684G>A - p.(Val562Ile) - Trans
CBAVD 919homozygotec.1210-34_1210-6TG[11]T[5] - Trans
c.1684G>A - p.(Val562Ile) - Trans
c.3846G>A - p.(Trp1282*) - Trans
CBAVD 881homozygotec.1210-34_1210-6TG[11]T[5] - Trans
c.617T>G - p.(Leu206Trp) - Trans
CBAVD 725homozygotec.1210-34_1210-6TG[11]T[5] - Trans
c.1684G>A - p.(Val562Ile) - Trans
c.3846G>A - p.(Trp1282*) - Trans
CBAVD 1287homozygotec.1210-34_1210-6TG[12]T[5] - Trans
c.870-1113_870-1110del - p.(=) - Trans
Pancreatitis 648heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Bronchiectasis 1237heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
Bronchiectasis 693heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
VUS1- Undef
Bronchiectasis 777homozygotec.1210-34_1210-6TG[11]T[5] - Trans
c.1684G>A - p.(Val562Ile) - Trans
Bronchiectasis 966homozygotec.1585-9418T>C - p.(=) - Trans
c.899C>A - p.(Ala300Asp) - Trans
Pending (NBS) 5808heterozygoteCF-causing- Undef
VUS3- Undef
Pending (NBS) 4769heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Pending (NBS) 991heterozygoteCFTR-RD-causing- Undef
varying clinical consequence- Undef
CFTR-RD-causing- Undef
Pending (NBS) 1522heterozygoteCF-causing- Undef
non-CF- Undef
Pending (NBS) 5190heterozygoteCF-causing- Undef
VUS3- Undef
VUS3- Undef
varying clinical consequence- Undef
Pending (NBS) 5202heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
VUS3- Undef
Pending (NBS) 794heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Pending (NBS) 799heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Pending (NBS) 803heterozygoteVUS2- Undef
CF-causing- Undef
CRS-NP 5531heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
VUS3- Undef
CRS-NP 1554heterozygoteCF-causing- Undef
Asymptomatic compound heterozygote 3020heterozygotevarying clinical consequence- Undef
CF-causing- Undef
Asymptomatic compound heterozygote 5745homozygotec.1210-34_1210-6TG[11]T[5] - Trans
c.3256A>G - p.(Thr1086Ala) - Trans
Aquagenic palmoplantar keratoderma 5822heterozygoteVUS3- Undef
non-CF- Undef


Color code:   non disease-causing <   likely benign <   VUS <   likely pathogenic <   disease-causing



            CFTR variants are clustered into five groups:
  • CF-causing: when in trans with another CF-causing mutation, will result in CF.
  • CFTR-RD causing: when in trans with a CF-causing mutation, will result in CFTR-related disorders (CFTR-RD) such as chronic pancreatitis, bronchiectasis, CRS-NP (chronic rhinosinusitis with or without nasal polyposis) or CBAVD (congenital absence of vas deferens), according to Bombieri C et al., 2011.
  • Varying clinical consequence: when in trans with another CF-causing mutation, can either result in CF or in a CFTR-RD.
  • Non disease-causing: when in trans with a CF-causing mutation, will not cause CF, nor CFTR-RD.
  • VUS (Variant of unknown clinical significance): unclassified because of insufficient data.



Go to CFTRare