Variant NM_000492.4:c.2834C>T


Variant details:
Name NM_000492.4:c.2834C>T
Protein name NP_000483.3:p.(Ser945Leu)
Genomic name (hg19) chr7:g.117243762C>T    UCSC    
#Exon/intron exon 17
Legacy Name S945L
Class disease-causing
Subclass varying clinical consequence
WT sequence CTGGTGCATACTCTAATCACAGTGT C GAAAATTTTACACCACAAAATGTTA
Mutant sequence CTGGTGCATACTCTAATCACAGTGT T GAAAATTTTACACCACAAAATGTTA

Other databases:
dbSNP
rs397508442



Pathogenicity predictors:

Functional studies:


Reference PMID Splicing mRNA level Maturation Localization Channel fonction (Cl-) Bicarbonate
Seibert et al, 1996 8910333 ✓ ✓
Van Goor et al, 2014 23891399 ✓ ✓ ✓
Sosnay et al, 2013 23974870 ✓ ✓


« ✓ » indicates the type of analysis performed and not the results


Response to modulators:


Modulator FDA approval EMA approval in vitro / ex vivo data clinical data
IVA yesnono yes
TEZ-IVA yes yesno yes
ELX-TEZ-IVA yesnoyesno


clinical and functional data are provided by Vertex


No patient found in CFTR-NGS catalogue


30 patients carrying this variant are reported in CFTR-France:

TOTAL NUMBER OF PATIENTS 30
CF 15
CFTR-RD10
  • Bronchiectasis  1
  • CBAVD  2
  • Other  6
  • Pancreatitis  1
Pending (NBS) 5




Color code:   non disease-causing <   likely benign <   VUS <   likely pathogenic <   disease-causing

Detailed genotypes:
Phenotype Patient ID Variant status Additional variants
CF 392heterozygoteVUS3 - Trans
CF-causing - Trans
CF 2181heterozygoteCF-causing- Undef
CF 2283heterozygoteCF-causing- Undef
CF 2576heterozygoteCF-causing- Undef
CF 4142heterozygoteCF-causing - Trans
CF 4268heterozygoteCF-causing- Undef
CF 4349heterozygoteCF-causing - Trans
CF 4359heterozygotevarying clinical consequence - Trans
CF 622heterozygoteCF-causing - Trans
CF 623heterozygoteCF-causing - Trans
CF 997heterozygoteCF-causing - Trans
CF 4788heterozygoteCF-causing - Trans
CF 5189heterozygoteCF-causing - Trans
VUS3- Undef
CF 1570heterozygoteCF-causing - Trans
CF 1702heterozygoteCF-causing- Undef
Other 6187heterozygoteCF-causing- Undef
Other 5048heterozygoteCF-causing- Undef
Other 1017heterozygoteCF-causing- Undef
Other 1098heterozygoteCF-causing - Trans
Other 1185heterozygoteCF-causing - Trans
Other 1040homozygotec.2834C>T - p.(Ser945Leu) - Trans
Pending (NBS) 3658heterozygoteCF-causing - Trans
Pending (NBS) 6028heterozygoteCF-causing- Undef
Pending (NBS) 5450heterozygoteCF-causing - Trans
Pending (NBS) 4787heterozygoteCF-causing - Trans
VUS3- Undef
Pending (NBS) 6031heterozygoteCF-causing- Undef
Pancreatitis 1703heterozygoteCF-causing- Undef
Bronchiectasis 2254heterozygoteCF-causing- Undef
CBAVD 4653heterozygoteCFTR-RD-causing- Undef
CBAVD 4532heterozygoteCFTR-RD-causing- Undef


Color code:   non disease-causing <   likely benign <   VUS <   likely pathogenic <   disease-causing



            CFTR variants are clustered into five groups:
  • CF-causing: when in trans with another CF-causing mutation, will result in CF.
  • CFTR-RD causing: when in trans with a CF-causing mutation, will result in CFTR-related disorders (CFTR-RD) such as chronic pancreatitis, bronchiectasis, CRS-NP (chronic rhinosinusitis with or without nasal polyposis) or CBAVD (congenital absence of vas deferens), according to Bombieri C et al., 2011.
  • Varying clinical consequence: when in trans with another CF-causing mutation, can either result in CF or in a CFTR-RD.
  • Non disease-causing: when in trans with a CF-causing mutation, will not cause CF, nor CFTR-RD.
  • VUS (Variant of unknown clinical significance): unclassified because of insufficient data.



Go to CFTRare