Variant NM_000492.4:c.3196C>T


Variant details:
Name NM_000492.4:c.3196C>T
Protein name NP_000483.3:p.(Arg1066Cys)
Genomic name (hg19)     chr7:g.117251691C>T    UCSC    
Genomic name (hg38) chr7:g.117611637C>T    UCSC
#Exon/intron exon 20
Legacy Name R1066C
Class disease-causing
Subclass CF-causing
WT sequence AAGCTTAAAAGGACTATGGACACTT C GTGCCTTCGGACGGCAGCCTTACTT
Mutant sequence AAGCTTAAAAGGACTATGGACACTT T GTGCCTTCGGACGGCAGCCTTACTT

Other databases:
dbSNP
rs78194216



Pathogenicity predictors:

Functional studies:         +


Reference PMID Splicing mRNA level Maturation Localization Channel fonction (Cl-) Bicarbonate
Seibert et al, 1996 8662892 ✓ ✓
Cotten et al, 1996 8702904 ✓ ✓
Van Goor et al, 2014 23891399 ✓ ✓ ✓
Sosnay et al, 2013 23974870 ✓ ✓


« ✓ » indicates the type of analysis performed and not the results


Response to modulators:         +


Modulator FDA approval EMA approval in vitro / ex vivo data clinical data
VNZ-TEZ-DIVA yesnoyesno

clinical and functional data presented above are provided by Vertex



Reference PMID Modulator in vitro / ex vivo data clinical data Patient responsiveness
Burgel et al., 2024 39151434 ELX-TEZ-IVAN.D. yes yes

variant responsiveness based on clinical data, sweat chloride concentration, ppFEV1, chest CT imaging before and after ETI treatment (n ≥ 3 patients for 6-8 weeks)


No patient found in CFTR-NGS catalogue


20 patients carrying this variant are reported in CFTR-France:

TOTAL NUMBER OF PATIENTS 20
CF 16
CFTR-RD4
  • CBAVD  3
  • Pancreatitis  1




Color code:   non disease-causing <   likely benign <   VUS <   likely pathogenic <   disease-causing

Detailed genotypes:
Phenotype Patient ID Variant status Additional variants
CBAVD 4710heterozygoteCFTR-RD-causing- Undef
VUS3- Undef
CBAVD 1660heterozygotevarying clinical consequence- Undef
CBAVD 543heterozygoteVUS3 - Trans
CF 1919heterozygoteVUS4 - Cis
CF-causing - Trans
CF 5885heterozygoteCF-causing - Trans
CF 2439heterozygoteCF-causing- Undef
CF 2596heterozygoteCF-causing- Undef
CF 3001heterozygoteCF-causing - Trans
CF 3026heterozygoteVUS3 - Cis
CF-causing - Trans
CF 3194heterozygoteCF-causing - Trans
CF 4169heterozygotevarying clinical consequence- Undef
CF 1517heterozygoteVUS3- Undef
CF-causing- Undef
CF 222heterozygoteCF-causing- Undef
CF 308heterozygoteCF-causing - Trans
CF 488heterozygotevarying clinical consequence - Trans
CF 596heterozygoteCF-causing- Undef
CF 597heterozygoteCF-causing- Undef
CF 5135heterozygoteCF-causing - Trans
CF 4594heterozygoteCF-causing - Trans
VUS3- Undef
Pancreatitis 4849homozygotec.3196C>T - p.(Arg1066Cys) - Trans


Color code:   non disease-causing <   likely benign <   VUS <   likely pathogenic <   disease-causing



            CFTR variants are clustered into five groups (click here for more details about the classification of variants):
  • CF-causing: when in trans with another CF-causing mutation, will result in CF.
  • CFTR-RD causing: when in trans with a CF-causing mutation, will result in CFTR-related disorders (CFTR-RD) such as chronic pancreatitis, bronchiectasis, CRS-NP (chronic rhinosinusitis with or without nasal polyposis) or CBAVD (congenital absence of vas deferens), according to Bombieri C et al., 2011.
  • Varying clinical consequence: when in trans with another CF-causing mutation, can either result in CF or in a CFTR-RD.
  • Non disease-causing: when in trans with a CF-causing mutation, will not cause CF, nor CFTR-RD.
  • VUS (Variant of unknown clinical significance): unclassified because of insufficient data.



Go to CFTRare