Variant NM_000492.4:c.3484C>T


Variant details:
Name NM_000492.4:c.3484C>T
Protein name NP_000483.3:p.(Arg1162*)
Genomic name (hg19)     chr7:g.117267591C>T    UCSC    
Genomic name (hg38) chr7:g.117627537C>T    UCSC
#Exon/intron exon 22
Legacy Name R1162X
Class disease-causing
Subclass CF-causing
WT sequence TTTATTTCAGATGCGATCTGTGAGC C GAGTCTTTAAGTTCATTGACATGCC
Mutant sequence TTTATTTCAGATGCGATCTGTGAGC T GAGTCTTTAAGTTCATTGACATGCC

Other databases:
dbSNP
rs74767530







Pathogenicity predictors:

Not found





Reference PMID Modulator in vitro / ex vivo data Clinical data Variant responsiveness
Burgel et al., 2024 39151434 ELX-TEZ-IVAN.D. yesno

variant non responsiveness based on clinical data, sweat chloride concentration, ppFEV1, chest CT imaging before and after ETI treatment (n ≥ 3 patients for 6-8 weeks)


No patient found in CFTR-NGS catalogue


36 patients carrying this variant are reported in CFTR-France:

TOTAL NUMBER OF PATIENTS 36
Asymptomatic compound heterozygote 1
CF 29
CFTR-RD4
  • CBAVD  3
  • Other  1
Pending 1
Pending (NBS) 1




Color code:   non disease-causing <   likely benign <   VUS <   likely pathogenic <   disease-causing

Detailed genotypes:
Phenotype Patient ID Variant status Additional variants
CF 6105heterozygoteCF-causing- Undef
CF 2048heterozygoteCF-causing- Undef
CF 2548heterozygoteCF-causing- Undef
CF 3171heterozygoteCF-causing- Undef
CF 3179heterozygoteCF-causing - Trans
CF 3400heterozygoteCF-causing - Trans
CF 3418heterozygoteCF-causing - Trans
CF 3436heterozygoteCF-causing- Undef
CF 3505heterozygoteCF-causing- Undef
CF 3685heterozygoteCF-causing - Trans
CF 4098heterozygoteCF-causing- Undef
CF 4206heterozygoteCF-causing- Undef
CF 4507heterozygoteCF-causing- Undef
CF 4521heterozygoteCF-causing - Trans
CF 6253heterozygoteCF-causing - Trans
CF 5373heterozygotevarying clinical consequence- Undef
CF 5113heterozygoteVUS3- Undef
CF 616heterozygoteCF-causing - Trans
CF 637heterozygotevarying clinical consequence - Trans
CF 649heterozygoteCF-causing - Trans
CF 706heterozygoteCF-causing - Trans
CF 929heterozygoteCF-causing - Trans
CF 1085heterozygoteCF-causing - Trans
CF 1150heterozygoteCF-causing - Trans
CF 1298heterozygoteCF-causing - Trans
CF 1531heterozygoteCF-causing - Trans
CF 1652heterozygoteCF-causing- Undef
CF 2567homozygotec.3484C>T - p.(Arg1162*) - Trans
CF 22homozygotec.3484C>T - p.(Arg1162*) - Trans
Other 464heterozygoteCFTR-RD-causing- Undef
Asymptomatic compound heterozygote 5812heterozygote
CBAVD 5819heterozygoteCFTR-RD-causing- Undef
CBAVD 1430heterozygoteCFTR-RD-causing - Trans
CBAVD 5002heterozygoteVUS3- Undef
Pending 3035heterozygote
Pending (NBS) 4555heterozygoteCFTR-RD-causing- Undef


Color code:   non disease-causing <   likely benign <   VUS <   likely pathogenic <   disease-causing



            CFTR variants are clustered into five groups (click here for more details about the classification of variants):
  • CF-causing: when in trans with another CF-causing mutation, will result in CF.
  • CFTR-RD causing: when in trans with a CF-causing mutation, will result in CFTR-related disorders (CFTR-RD) such as chronic pancreatitis, bronchiectasis, CRS-NP (chronic rhinosinusitis with or without nasal polyposis) or CBAVD (congenital absence of vas deferens), according to Bombieri C et al., 2011.
  • Varying clinical consequence: when in trans with another CF-causing mutation, can either result in CF or in a CFTR-RD.
  • Non disease-causing: when in trans with a CF-causing mutation, will not cause CF, nor CFTR-RD.
  • VUS (Variant of unknown clinical significance): unclassified because of insufficient data.



Go to CFTRare