Updates for c.948del:
2023-02-02 name changed from c.948delT to c.948del




Variant NM_000492.4:c.948del


Variant details:
Name NM_000492.4:c.948del
Protein name NP_000483.3:p.(Phe316Leufs*12)
Genomic name (hg19)     chr7:g.117180232del    UCSC    
Genomic name (hg38) chr7:g.117540178del    UCSC
#Exon/intron exon 8
Legacy Name 1078delT
Class disease-causing
Subclass CF-causing
WT sequence CAGCCTTCTTCTTCTCAGGGTTCTT T GTGGTGTTTTTATCTGTGCTTCCCT
Mutant sequence CAGCCTTCTTCTTCTCAGGGTTCTT - GTGGTGTTTTTATCTGTGCTTCCCT

Other databases:
dbSNP
rs121908744







Pathogenicity predictors:

Not found





Reference PMID Modulator in vitro / ex vivo data clinical data Patient responsiveness
Burgel et al., 2024 39151434 ELX-TEZ-IVAN.D. yesno



No patient found in CFTR-NGS catalogue


41 patients carrying this variant are reported in CFTR-France:

TOTAL NUMBER OF PATIENTS 41
CF 36
CFTR-RD2
  • CBAVD  2
Pending (NBS) 3




Color code:   non disease-causing <   likely benign <   VUS <   likely pathogenic <   disease-causing

Detailed genotypes:
Phenotype Patient ID Variant status Additional variants
CBAVD 1339heterozygoteCFTR-RD-causing- Undef
CBAVD 4696heterozygotevarying clinical consequence- Undef
CF 6113heterozygoteCF-causing- Undef
CF 3755heterozygoteCF-causing- Undef
CF 3765heterozygoteCF-causing - Trans
CF 3772heterozygoteCF-causing- Undef
CF 3795heterozygoteCF-causing- Undef
CF 3985heterozygoteCF-causing- Undef
CF 4038heterozygoteCF-causing- Undef
CF 4054heterozygoteCF-causing- Undef
CF 4055heterozygoteCF-causing- Undef
CF 4060heterozygoteCF-causing - Trans
CF 4076heterozygoteCF-causing- Undef
CF 4099heterozygoteCF-causing- Undef
CF 4126heterozygoteCF-causing - Trans
CF 4143heterozygoteCF-causing - Trans
CF 4185heterozygoteCF-causing- Undef
CF 4194heterozygoteCF-causing- Undef
CF 6497heterozygoteCF-causing- Undef
CF 3749heterozygoteCF-causing- Undef
CF 3714heterozygoteCF-causing- Undef
CF 3697heterozygoteCF-causing- Undef
CF 2621heterozygoteCF-causing- Undef
CF 2616heterozygoteCF-causing- Undef
CF 848heterozygoteCF-causing - Trans
CF 371heterozygoteCF-causing - Trans
CF 154heterozygoteCF-causing - Trans
CF 2658heterozygoteCF-causing- Undef
CF 2687heterozygoteCF-causing - Trans
CF 3518heterozygoteCF-causing - Trans
CF 3692heterozygoteCF-causing- Undef
CF 3618heterozygoteCF-causing- Undef
CF 3604heterozygoteCF-causing- Undef
CF 3586heterozygoteCF-causing - Trans
CF 3536heterozygoteCF-causing- Undef
CF 3578homozygotec.948del - p.(Phe316Leufs*12) - Trans
CF 3760homozygotec.948del - p.(Phe316Leufs*12) - Trans
CF 3759homozygotec.948del - p.(Phe316Leufs*12) - Trans
Pending (NBS) 5784heterozygotevarying clinical consequence - Trans
Pending (NBS) 5443heterozygotevarying clinical consequence - Trans
Pending (NBS) 5046heterozygotevarying clinical consequence- Undef


Color code:   non disease-causing <   likely benign <   VUS <   likely pathogenic <   disease-causing



            CFTR variants are clustered into five groups (click here for more details about the classification of variants):
  • CF-causing: when in trans with another CF-causing mutation, will result in CF.
  • CFTR-RD causing: when in trans with a CF-causing mutation, will result in CFTR-related disorders (CFTR-RD) such as chronic pancreatitis, bronchiectasis, CRS-NP (chronic rhinosinusitis with or without nasal polyposis) or CBAVD (congenital absence of vas deferens), according to Bombieri C et al., 2011.
  • Varying clinical consequence: when in trans with another CF-causing mutation, can either result in CF or in a CFTR-RD.
  • Non disease-causing: when in trans with a CF-causing mutation, will not cause CF, nor CFTR-RD.
  • VUS (Variant of unknown clinical significance): unclassified because of insufficient data.



Go to CFTRare