Variant NM_000492.4:c.2909-92G>A


Variant details:
Name NM_000492.4:c.2909-92G>A
Protein name NP_000483.3:p.(=)
Genomic name (hg19)     chr7:g.117246636G>A    UCSC    
Genomic name (hg38) chr7:g.117606582G>A    UCSC
#Exon/intron intron 17
Legacy Name 3041-92G/A
Class non disease-causing
WT sequence TAATTCTTATTTGGGTTCTGAATGC G TCTACTGTGATCCAAACTTAGTATT
Mutant sequence TAATTCTTATTTGGGTTCTGAATGC A TCTACTGTGATCCAAACTTAGTATT

Other databases:

Not found
dbSNP
rs35050470







Pathogenicity predictors:

Not found





55 individuals carrying this variant are reported in CFTR-NGS catalogue


200 patients carrying this variant are reported in CFTR-France:

TOTAL NUMBER OF PATIENTS 200
Asymptomatic compound heterozygote 18
CF 36
CFTR-RD126
  • Aquagenic palmoplantar keratoderma  4
  • Bronchiectasis  14
  • CBAVD  70
  • CRS-NP  2
  • Other  20
  • Pancreatitis  16
Pending 1
Pending (NBS) 17
Pending non-CF 2




Color code:   non disease-causing <   likely benign <   VUS <   likely pathogenic <   disease-causing

Detailed genotypes:
Phenotype Patient ID Variant status Additional variants
CF 4765heterozygoteVUS3- Undef
varying clinical consequence- Undef
CF-causing- Undef
CF 5345heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 5174heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 5016heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 5622heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 5777heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
VUS3- Undef
CF 5965heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 5948heterozygoteCF-causing- Undef
CF-causing- Undef
CF 6456heterozygoteCF-causing- Undef
varying clinical consequence- Undef
VUS3- Undef
CF 6453heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 5341heterozygoteVUS3- Undef
CF-causing- Undef
CF 5328heterozygoteCF-causing- Undef
CF-causing- Undef
CF 663heterozygoteVUS2- Undef
CF-causing- Undef
varying clinical consequence- Undef
CF 662heterozygoteVUS2- Undef
CF-causing- Undef
varying clinical consequence- Undef
CF 654heterozygoteCF-causing- Undef
CF-causing- Undef
CF 745heterozygoteCF-causing- Undef
CF-causing- Undef
CF 4697heterozygoteCF-causing- Undef
CF-causing- Undef
CF 383heterozygotevarying clinical consequence- Undef
CF-causing- Undef
CF-causing- Undef
CF 316heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 4665heterozygoteVUS3- Undef
CF 909heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 4629heterozygoteCF-causing- Undef
CF-causing- Undef
VUS1- Undef
CF 920heterozygoteVUS2- Undef
CF-causing- Undef
CF-causing- Undef
CF 945heterozygoteCF-causing- Undef
CF-causing- Undef
CF 947heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 5807heterozygoteCF-causing- Undef
VUS3- Undef
CF 829heterozygoteCF-causing- Undef
varying clinical consequence- Undef
VUS3- Undef
CF 5215heterozygoteCFTR-RD-causing- Undef
VUS3- Undef
CF 816heterozygoteCF-causing- Undef
CF-causing- Undef
CF 808heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 4718homozygotec.2374C>T - p.(Arg792*) - Trans
c.870-1113_870-1110del - p.(=) - Trans
CF 4688homozygotec.1519_1521del - p.(Ile507del) - Trans
c.2657+5G>A - p.(=) - Trans
CF 730homozygotec.3131A>G - p.(Glu1044Gly) - Trans
CF 5069homozygotec.1393-1G>A - p.(=) - Trans
c.1680-981T>C - p.(=) - Trans
c.3874-4522A>G - p.(=) - Trans
CF 901homozygotec.2657+5G>A - p.(=) - Trans
CF 882homozygotec.1518C>G - p.(Ile506Met) - Trans
c.1521_1523del - p.(Phe508del) - Trans
Other 5763heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
non-CF- Undef
Other 4625heterozygoteVUS3- Undef
Other 5825heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Other 5823heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
non-CF- Undef
VUS3- Undef
Other 5224heterozygoteVUS3- Undef
CFTR-RD-causing- Undef
Other 5575heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Other 4760heterozygoteVUS3- Undef
Other 6438heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
VUS3- Undef
Other 5967heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Other 4686heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Other 4671heterozygoteVUS3- Undef
Other 4835heterozygoteCFTR-RD-causing- Undef
VUS3- Undef
Other 5083heterozygoteVUS3- Undef
CF-causing- Undef
Other 5087heterozygoteCFTR-RD-causing- Undef
VUS3- Undef
Other 4826heterozygoteCFTR-RD-causing- Undef
CFTR-RD-causing- Undef
Other 935heterozygoteCFTR-RD-causing- Undef
Other 940heterozygoteCF-causing- Undef
Other 972heterozygoteCF-causing- Undef
Other 5743heterozygoteCF-causing- Undef
VUS3- Undef
CFTR-RD-causing- Undef
Other 5082homozygotec.1116+1G>A - p.(=) - Trans
c.1210-34_1210-6TG[11]T[5] - Trans
CBAVD 5944heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 5591heterozygoteCFTR-RD-causing- Undef
varying clinical consequence- Undef
CBAVD 5590heterozygoteVUS3- Undef
CF-causing- Undef
CBAVD 5346heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 5343heterozygoteVUS3- Undef
VUS3- Undef
CBAVD 5173heterozygoteCF-causing- Undef
varying clinical consequence- Undef
VUS3- Undef
CBAVD 5330heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 1276heterozygoteCFTR-RD-causing- Undef
CFTR-RD-causing- Undef
CBAVD 5821heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 4653heterozygoteCFTR-RD-causing- Undef
varying clinical consequence- Undef
CBAVD 4651heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
VUS1- Undef
CBAVD 3267heterozygoteVUS3- Undef
CF-causing- Undef
CBAVD 3125heterozygoteCF-causing- Undef
VUS1- Undef
varying clinical consequence- Undef
CBAVD 4752heterozygoteVUS3- Undef
CF-causing- Undef
CBAVD 4756heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 5228heterozygoteCFTR-RD-causing- Undef
VUS3- Undef
CBAVD 5600heterozygoteVUS3- Undef
CBAVD 5768heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 5947heterozygoteVUS3- Undef
CF-causing- Undef
CBAVD 5943heterozygoteVUS3- Undef
CF-causing- Undef
CBAVD 5764heterozygoteVUS3- Undef
CF-causing- Undef
CBAVD 6455heterozygoteCF-causing- Undef
VUS3- Undef
CBAVD 6454heterozygoteCFTR-RD-causing- Undef
non-CF- Undef
CFTR-RD-causing- Undef
CBAVD 6458heterozygoteVUS3- Undef
CF-causing- Undef
CBAVD 5314heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 676heterozygoteCFTR-RD-causing- Undef
CBAVD 665heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 664heterozygote
CBAVD 659heterozygoteVUS3- Undef
VUS3- Undef
CBAVD 658heterozygoteVUS3- Undef
CF-causing- Undef
CBAVD 656heterozygotevarying clinical consequence- Undef
CF-causing- Undef
CBAVD 682heterozygoteVUS3- Undef
CF-causing- Undef
CBAVD 690heterozygote
CBAVD 781heterozygoteCFTR-RD-causing- Undef
CBAVD 765heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 763heterozygoteVUS3- Undef
CF-causing- Undef
CBAVD 743heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 735heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 720heterozygoteCFTR-RD-causing- Undef
CBAVD 710heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 653heterozygoteCFTR-RD-causing- Undef
varying clinical consequence- Undef
varying clinical consequence- Undef
CBAVD 4706heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 4683heterozygoteVUS3- Undef
CF-causing- Undef
CBAVD 4679heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 4837heterozygoteCFTR-RD-causing- Undef
varying clinical consequence- Undef
CBAVD 643heterozygoteCFTR-RD-causing- Undef
varying clinical consequence- Undef
CBAVD 423heterozygoteVUS3- Undef
CBAVD 5072heterozygoteCF-causing- Undef
VUS3- Undef
CBAVD 4735heterozygoteVUS3- Undef
varying clinical consequence- Undef
CBAVD 858heterozygote
CBAVD 887heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 892heterozygotevarying clinical consequence- Undef
VUS3- Undef
CBAVD 900heterozygoteVUS3- Undef
CF-causing- Undef
CBAVD 912heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 941heterozygoteVUS4- Undef
CF-causing- Undef
CBAVD 857heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 818heterozygote
CBAVD 949heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 812heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 805heterozygoteVUS1- Undef
CBAVD 856heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 840heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 834heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 5592homozygotec.1210-34_1210-6TG[12]T[5] - Trans
c.233dup - p.(Trp79Leufs*32) - Trans
CBAVD 5129homozygotec.1519_1521del - p.(Ile507del) - Trans
c.1704G>T - p.(Leu568Phe) - Trans
CBAVD 5610homozygotec.1327G>T - p.(Asp443Tyr) - Trans
c.1521_1523del - p.(Phe508del) - Trans
CBAVD 725homozygotec.1210-34_1210-6TG[11]T[5] - Trans
c.1684G>A - p.(Val562Ile) - Trans
c.3846G>A - p.(Trp1282*) - Trans
CBAVD 919homozygotec.1210-34_1210-6TG[11]T[5] - Trans
c.1684G>A - p.(Val562Ile) - Trans
c.3846G>A - p.(Trp1282*) - Trans
CBAVD 881homozygotec.1210-34_1210-6TG[11]T[5] - Trans
c.617T>G - p.(Leu206Trp) - Trans
CBAVD 908homozygotec.1210-34_1210-6TG[11]T[5] - Trans
c.1466C>T - p.(Ser489Leu) - Trans
c.1684G>A - p.(Val562Ile) - Trans
Pancreatitis 4659heterozygoteVUS3- Undef
Pancreatitis 4619heterozygoteCFTR-RD-causing- Undef
VUS3- Undef
Pancreatitis 3259heterozygotevarying clinical consequence- Undef
CF-causing- Undef
Pancreatitis 5619heterozygoteVUS3- Undef
Pancreatitis 5614heterozygoteVUS3- Undef
Pancreatitis 5605heterozygoteVUS2- Undef
Pancreatitis 5621heterozygote
Pancreatitis 5977heterozygoteVUS3- Undef
Pancreatitis 5364heterozygoteVUS3- Undef
Pancreatitis 5340heterozygoteVUS3- Undef
Pancreatitis 5336heterozygoteVUS3- Undef
VUS3- Undef
Pancreatitis 5329heterozygotevarying clinical consequence- Undef
Pancreatitis 5155heterozygoteVUS3- Undef
VUS3- Undef
Pancreatitis 5171heterozygoteVUS3- Undef
VUS3- Undef
Pancreatitis 648heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Pancreatitis 4708heterozygoteCFTR-RD-causing- Undef
VUS3- Undef
Bronchiectasis 4657heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Bronchiectasis 5530heterozygoteCFTR-RD-causing- Undef
CFTR-RD-causing- Undef
Bronchiectasis 5624heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Bronchiectasis 693heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
VUS1- Undef
Bronchiectasis 4726heterozygoteCFTR-RD-causing- Undef
varying clinical consequence- Undef
Bronchiectasis 4725heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
Bronchiectasis 5074heterozygoteCFTR-RD-causing - Cis
CFTR-RD-causing - Trans
Bronchiectasis 5126homozygotec.1327G>T - p.(Asp443Tyr) - Trans
Bronchiectasis 966homozygotec.1585-9418T>C - p.(=) - Trans
c.899C>A - p.(Ala300Asp) - Trans
Bronchiectasis 5972homozygotec.1210-34_1210-6TG[11]T[5] - Trans
c.870-1113_870-1110del - p.(=) - Trans
Bronchiectasis 6435homozygotec.1210-34_1210-6TG[11]T[5] - Trans
c.870-1113_870-1110del - p.(=) - Trans
Bronchiectasis 6436homozygotec.3303G>A - p.(Met1101Ile) - Trans
Bronchiectasis 5076homozygotec.2658-77T>A - p.(=) - Trans
Bronchiectasis 777homozygotec.1210-34_1210-6TG[11]T[5] - Trans
c.1684G>A - p.(Val562Ile) - Trans
Asymptomatic compound heterozygote 4763heterozygoteCF-causing- Undef
Asymptomatic compound heterozygote 4617heterozygoteVUS3 - Cis
CF-causing - Trans
Asymptomatic compound heterozygote 4628heterozygoteVUS3- Undef
CFTR-RD-causing- Undef
Asymptomatic compound heterozygote 5525heterozygoteVUS3- Undef
Asymptomatic compound heterozygote 5362heterozygoteVUS3- Undef
VUS3- Undef
Asymptomatic compound heterozygote 5606heterozygoteCFTR-RD-causing- Undef
non-CF- Undef
CF-causing- Undef
Asymptomatic compound heterozygote 5602heterozygoteVUS3- Undef
VUS3- Undef
Asymptomatic compound heterozygote 5601heterozygoteCF-causing- Undef
Asymptomatic compound heterozygote 5964heterozygoteVUS3- Undef
CF-causing- Undef
Asymptomatic compound heterozygote 6437heterozygoteCFTR-RD-causing- Undef
VUS3- Undef
Asymptomatic compound heterozygote 6434heterozygoteCFTR-RD-causing- Undef
VUS3- Undef
Asymptomatic compound heterozygote 5167heterozygotevarying clinical consequence- Undef
Asymptomatic compound heterozygote 5073heterozygote
Asymptomatic compound heterozygote 5077heterozygoteVUS3- Undef
Asymptomatic compound heterozygote 5220heterozygoteCFTR-RD-causing- Undef
non-CF- Undef
Asymptomatic compound heterozygote 5745homozygotec.1210-34_1210-6TG[11]T[5] - Trans
c.3256A>G - p.(Thr1086Ala) - Trans
Asymptomatic compound heterozygote 5218homozygotec.1210-34_1210-6TG[11]T[5] - Trans
c.2758G>T - p.(Val920Leu) - Trans
c.3409A>G - p.(Met1137Val) - Trans
Asymptomatic compound heterozygote 4741homozygotec.489+3A>G - p.(=) - Trans
Pending (NBS) 4645heterozygoteCF-causing- Undef
VUS3- Undef
Pending (NBS) 4654heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Pending (NBS) 4631heterozygotevarying clinical consequence- Undef
CF-causing- Undef
Pending (NBS) 4643heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
Pending (NBS) 5808heterozygoteCF-causing- Undef
VUS3- Undef
Pending (NBS) 5247heterozygoteCFTR-RD-causing- Undef
VUS3- Undef
CF-causing- Undef
VUS1- Undef
Pending (NBS) 5017heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
Pending (NBS) 5609heterozygoteVUS3- Undef
CF-causing- Undef
Pending (NBS) 5951heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Pending (NBS) 5769heterozygoteCF-causing- Undef
varying clinical consequence- Undef
VUS3- Undef
Pending (NBS) 5342heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Pending (NBS) 6457heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Pending (NBS) 799heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Pending (NBS) 794heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Pending (NBS) 387heterozygoteCF-causing- Undef
VUS3- Undef
Pending (NBS) 803heterozygoteVUS2- Undef
CF-causing- Undef
Pending (NBS) 4644homozygotec.1209G>C - p.(Glu403Asp) - Trans
c.2657+5G>A - p.(=) - Trans
Pending non-CF 4825heterozygoteVUS3- Undef
varying clinical consequence- Undef
Pending non-CF 5009heterozygoteVUS3- Undef
CF-causing- Undef
CRS-NP 5138heterozygoteVUS3- Undef
CRS-NP 3161heterozygoteCF-causing- Undef
VUS1- Undef
varying clinical consequence- Undef
Aquagenic palmoplantar keratoderma 5149heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Aquagenic palmoplantar keratoderma 5613heterozygotenon-CF- Undef
Aquagenic palmoplantar keratoderma 4660homozygotec.2657+5G>A - p.(=) - Trans
Aquagenic palmoplantar keratoderma 5772homozygotec.4139C>T - p.(Thr1380Ile) - Trans
Pending 5008heterozygotevarying clinical consequence- Undef
CF-causing- Undef


Color code:   non disease-causing <   likely benign <   VUS <   likely pathogenic <   disease-causing



            CFTR variants are clustered into five groups:
  • CF-causing: when in trans with another CF-causing mutation, will result in CF.
  • CFTR-RD causing: when in trans with a CF-causing mutation, will result in CFTR-related disorders (CFTR-RD) such as chronic pancreatitis, bronchiectasis, CRS-NP (chronic rhinosinusitis with or without nasal polyposis) or CBAVD (congenital absence of vas deferens), according to Bombieri C et al., 2011.
  • Varying clinical consequence: when in trans with another CF-causing mutation, can either result in CF or in a CFTR-RD.
  • Non disease-causing: when in trans with a CF-causing mutation, will not cause CF, nor CFTR-RD.
  • VUS (Variant of unknown clinical significance): unclassified because of insufficient data.



Go to CFTRare