Variant NM_000492.4:c.*133dup


Variant details:
Name NM_000492.4:c.*133dup
Genomic name (hg19) chr7:g.117307295dup    UCSC    
#Exon/intron UTR 3
Legacy Name 4700T8/9
Class non disease-causing
WT sequence ACAAGGATGAATTAAGTTTTTTTTT - AAAAAAGAAACATTTGGTAAGGGGA
Mutant sequence ACAAGGATGAATTAAGTTTTTTTTT T AAAAAAGAAACATTTGGTAAGGGGA

Other databases:

Not found		dbSNP
no rs







Pathogenicity predictors:

Not found





No patient found in CFTR-NGS catalogue


87 patients carrying this variant are reported in CFTR-France:

TOTAL NUMBER OF PATIENTS 87
CF 21
CFTR-RD57
  • Bronchiectasis  3
  • CBAVD  47
  • Other  6
  • Pancreatitis  1
Pending (NBS) 9




Color code:   non disease-causing <   likely benign <   VUS <   likely pathogenic <   disease-causing

Detailed genotypes:
Phenotype Patient ID Variant status Additional variants
CF 863heterozygoteCF-causing- Undef
CF-causing- Undef
CF 886heterozygoteCF-causing- Undef
CF-causing- Undef
CF 945heterozygoteCF-causing- Undef
CF-causing- Undef
CF 943heterozygotevarying clinical consequence- Undef
CF-causing- Undef
CF 920heterozygoteVUS2- Undef
CF-causing- Undef
CF-causing- Undef
CF 745heterozygoteCF-causing- Undef
CF-causing- Undef
CF 654heterozygoteCF-causing- Undef
CF-causing- Undef
CF 652heterozygoteCF-causing- Undef
CF-causing- Undef
CF 637heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 570heterozygotevarying clinical consequence- Undef
CF-causing- Undef
CF 316heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 4665heterozygoteVUS3- Undef
CFTR-RD-causing- Undef
CF 718heterozygoteCF-causing- Undef
CF-causing- Undef
CF 716heterozygoteCF-causing- Undef
CF-causing- Undef
CF 686heterozygoteVUS3- Undef
CF 738heterozygoteCF-causing- Undef
CF-causing- Undef
CF 730homozygotec.3131A>G - p.(Glu1044Gly) - Trans
CF 901homozygotec.2657+5G>A - p.(=) - Trans
CF 829homozygotec.2810dup - p.(Val938Glyfs*37) - Trans
c.2989-313A>T - p.(=) - Trans
c.627A>G - p.(=) - Trans
CF 882homozygotec.1518C>G - p.(Ile506Met) - Trans
c.1521_1523del - p.(Phe508del) - Trans
CF 4688homozygotec.1519_1521del - p.(Ile507del) - Trans
c.2657+5G>A - p.(=) - Trans
Other 972heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
Other 940heterozygoteCF-causing- Undef
Other 935heterozygoteCFTR-RD-causing- Undef
Other 4686heterozygoteVUS3- Undef
CF-causing- Undef
Other 4695heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Other 4671homozygotec.1585-9449C>A - p.(=) - Trans
c.2002C>T - p.(Arg668Cys) - Trans
CBAVD 868heterozygoteCF-causing- Undef
likely CFTR-RD- Undef
CBAVD 858heterozygote
CBAVD 856heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 840heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 837heterozygotevarying clinical consequence- Undef
CF-causing- Undef
CBAVD 812heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 806heterozygoteVUS3- Undef
CBAVD 805heterozygoteVUS1- Undef
CBAVD 792heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 781heterozygoteVUS3- Undef
CBAVD 765heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 763heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 746heterozygoteCFTR-RD-causing- Undef
CBAVD 887heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 892heterozygoteCFTR-RD-causing- Undef
varying clinical consequence- Undef
CFTR-RD-causing- Undef
CFTR-RD-causing- Undef
CBAVD 986heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 978heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 949heterozygoteVUS3- Undef
CF-causing- Undef
CBAVD 941heterozygoteVUS4- Undef
CF-causing- Undef
CBAVD 938heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 927heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CFTR-RD-causing- Undef
CBAVD 912heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 900heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 894heterozygotevarying clinical consequence- Undef
VUS3- Undef
CBAVD 743heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 658heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 656heterozygotevarying clinical consequence- Undef
CF-causing- Undef
CBAVD 653heterozygoteCFTR-RD-causing- Undef
varying clinical consequence- Undef
varying clinical consequence- Undef
CBAVD 643heterozygoteCFTR-RD-causing- Undef
varying clinical consequence- Undef
CBAVD 423heterozygoteVUS3- Undef
CBAVD 4707heterozygotevarying clinical consequence- Undef
CF-causing- Undef
CBAVD 4679heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 659heterozygoteCFTR-RD-causing- Undef
CFTR-RD-causing- Undef
VUS3- Undef
CBAVD 664heterozygote
CBAVD 665heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 710heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 690heterozygote
CBAVD 818heterozygote
CBAVD 676heterozygoteVUS3- Undef
CBAVD 682heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 735heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 4683homozygotec.1327G>T - p.(Asp443Tyr) - Trans
c.1521_1523del - p.(Phe508del) - Trans
c.2002C>T - p.(Arg668Cys) - Trans
CBAVD 725homozygotec.1210-34_1210-6TG[11]T[5] - Trans
c.1684G>A - p.(Val562Ile) - Trans
c.3846G>A - p.(Trp1282*) - Trans
CBAVD 919homozygotec.1210-34_1210-6TG[11]T[5] - Trans
c.1684G>A - p.(Val562Ile) - Trans
c.3846G>A - p.(Trp1282*) - Trans
CBAVD 908homozygotec.1210-34_1210-6TG[11]T[5] - Trans
c.1466C>T - p.(Ser489Leu) - Trans
c.1684G>A - p.(Val562Ile) - Trans
CBAVD 720homozygotec.4097T>C - p.(Ile1366Thr) - Trans
CBAVD 881homozygotec.1210-34_1210-6TG[11]T[5] - Trans
c.617T>G - p.(Leu206Trp) - Trans
Pending (NBS) 991heterozygoteCFTR-RD-causing- Undef
varying clinical consequence- Undef
CFTR-RD-causing- Undef
Pending (NBS) 803heterozygoteVUS2- Undef
CF-causing- Undef
Pending (NBS) 799heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Pending (NBS) 794heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Pending (NBS) 951heterozygoteVUS2- Undef
CF-causing- Undef
likely CF- Undef
Pending (NBS) 646heterozygotevarying clinical consequence- Undef
CF-causing- Undef
Pending (NBS) 4694heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
Pending (NBS) 4693heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
Pending (NBS) 726heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Pancreatitis 669heterozygoteCF-causing- Undef
Bronchiectasis 966heterozygoteVUS3- Undef
VUS3- Undef
Bronchiectasis 693heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
VUS1- Undef
Bronchiectasis 777homozygotec.1210-34_1210-6TG[11]T[5] - Trans
c.1684G>A - p.(Val562Ile) - Trans


Color code:   non disease-causing <   likely benign <   VUS <   likely pathogenic <   disease-causing



            CFTR variants are clustered into five groups:
  • CF-causing: when in trans with another CF-causing mutation, will result in CF.
  • CFTR-RD causing: when in trans with a CF-causing mutation, will result in CFTR-related disorders (CFTR-RD) such as chronic pancreatitis, bronchiectasis, CRS-NP (chronic rhinosinusitis with or without nasal polyposis) or CBAVD (congenital absence of vas deferens), according to Bombieri C et al., 2011.
  • Varying clinical consequence: when in trans with another CF-causing mutation, can either result in CF or in a CFTR-RD.
  • Non disease-causing: when in trans with a CF-causing mutation, will not cause CF, nor CFTR-RD.
  • VUS (Variant of unknown clinical significance): unclassified because of insufficient data.



Go to CFTRare