Variant NM_000492.4:c.4137-139G>A


Variant details:
Name NM_000492.4:c.4137-139G>A
Protein name NP_000483.3:p.(=)
Genomic name (hg19) chr7:g.117305374G>A    UCSC    
#Exon/intron intron 25
Legacy Name 4269-139G/A
Class non disease-causing
WT sequence GGTTGAAAAGCTGATTGTGGCTAAC G CTATATCAACATTATGTGAAAAGAA
Mutant sequence GGTTGAAAAGCTGATTGTGGCTAAC A CTATATCAACATTATGTGAAAAGAA

Other databases:

Not found		dbSNP
rs4727855







Pathogenicity predictors:

Not found





56 individuals carrying this variant are reported in CFTR-NGS catalogue


183 patients carrying this variant are reported in CFTR-France:

TOTAL NUMBER OF PATIENTS 183
Asymptomatic compound heterozygote 17
CF 26
CFTR-RD124
  • Aquagenic palmoplantar keratoderma  5
  • Bronchiectasis  13
  • CBAVD  66
  • CRS-NP  2
  • Other  17
  • Pancreatitis  21
Pending (NBS) 15
Pending non-CF 1




Color code:   non disease-causing <   likely benign <   VUS <   likely pathogenic <   disease-causing

Detailed genotypes:
Phenotype Patient ID Variant status Additional variants
CF 5069heterozygoteCF-causing- Undef
VUS3- Undef
varying clinical consequence- Undef
CF 4629heterozygoteCF-causing- Undef
CF-causing- Undef
VUS1- Undef
CF 5807heterozygoteCF-causing- Undef
VUS3- Undef
CF 5215heterozygoteVUS3- Undef
CFTR-RD-causing- Undef
CFTR-RD-causing- Undef
CF 5777heterozygoteVUS3- Undef
CF-causing- Undef
VUS3- Undef
CF 5622heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 5965heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 5948heterozygoteCF-causing- Undef
CF-causing- Undef
CF 5770heterozygoteVUS3- Undef
CF-causing- Undef
CF 4744heterozygoteCF-causing- Undef
VUS3- Undef
CF 4765heterozygoteVUS3- Undef
varying clinical consequence- Undef
CF-causing- Undef
CF 5341heterozygoteVUS3- Undef
CF-causing- Undef
CF 5328heterozygoteCF-causing- Undef
CF-causing- Undef
CF 4665heterozygoteVUS3- Undef
CFTR-RD-causing- Undef
CF 383heterozygotevarying clinical consequence- Undef
CF-causing- Undef
CF-causing- Undef
CF 745heterozygoteCF-causing- Undef
CF-causing- Undef
CF 4697heterozygoteCF-causing- Undef
CF-causing- Undef
CF 4718heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 945heterozygoteCF-causing- Undef
CF-causing- Undef
CF 920heterozygoteVUS2- Undef
CF-causing- Undef
CF-causing- Undef
CF 816heterozygoteCF-causing- Undef
CF-causing- Undef
CF 829heterozygoteCF-causing- Undef
varying clinical consequence- Undef
VUS3- Undef
CF 4688homozygotec.1519_1521del - p.(Ile507del) - Trans
c.2657+5G>A - p.(=) - Trans
CF 730homozygotec.3131A>G - p.(Glu1044Gly) - Trans
CF 882homozygotec.1518C>G - p.(Ile506Met) - Trans
c.1521_1523del - p.(Phe508del) - Trans
CF 901homozygotec.2657+5G>A - p.(=) - Trans
Other 4760heterozygoteVUS3- Undef
Other 4625heterozygoteVUS3- Undef
Other 5743heterozygoteCF-causing- Undef
VUS3- Undef
CFTR-RD-causing- Undef
Other 5087heterozygoteVUS3- Undef
VUS3- Undef
Other 4826heterozygoteVUS3- Undef
CFTR-RD-causing- Undef
Other 5825heterozygoteVUS3- Undef
CF-causing- Undef
Other 5823heterozygoteVUS3- Undef
CF-causing- Undef
non-CF- Undef
VUS3- Undef
Other 5775heterozygoteCF-causing- Undef
VUS3- Undef
VUS3- Undef
Other 5175heterozygoteCF-causing- Undef
VUS3- Undef
Other 4686heterozygoteVUS3- Undef
CF-causing- Undef
Other 4671heterozygoteVUS3- Undef
CFTR-RD-causing- Undef
Other 5083heterozygoteCFTR-RD-causing- Undef
CFTR-RD-causing- Undef
CF-causing- Undef
Other 4835heterozygoteCFTR-RD-causing- Undef
VUS3- Undef
Other 940heterozygoteCF-causing- Undef
Other 935heterozygoteCFTR-RD-causing- Undef
Other 972heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
Other 5082homozygotec.1116+1G>A - p.(=) - Trans
c.1210-34_1210-6TG[11]T[5] - Trans
CBAVD 4752heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 4756heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 4651heterozygoteVUS3- Undef
CF-causing- Undef
VUS1- Undef
CBAVD 4653heterozygoteCFTR-RD-causing- Undef
varying clinical consequence- Undef
CBAVD 2421heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 3267heterozygoteVUS3- Undef
CF-causing- Undef
CBAVD 5229heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 5821heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 5228heterozygoteCFTR-RD-causing- Undef
VUS3- Undef
CBAVD 5943heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 5946heterozygoteCF-causing- Undef
VUS3- Undef
CBAVD 5768heterozygoteCF-causing- Undef
VUS3- Undef
CBAVD 5947heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 5944heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 5346heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 5173heterozygoteCF-causing- Undef
varying clinical consequence- Undef
VUS3- Undef
CBAVD 5330heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 5314heterozygoteVUS3- Undef
CF-causing- Undef
CBAVD 676heterozygoteVUS3- Undef
CBAVD 664heterozygote
CBAVD 659heterozygoteCFTR-RD-causing- Undef
CFTR-RD-causing- Undef
VUS3- Undef
CBAVD 656heterozygotevarying clinical consequence- Undef
CF-causing- Undef
CBAVD 423heterozygoteVUS3- Undef
CBAVD 682heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 690heterozygote
CBAVD 765heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 763heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 743heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 735heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 658heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 710heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 4706heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 4683heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 4679heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 5072heterozygoteCF-causing- Undef
VUS3- Undef
CBAVD 4837heterozygoteCFTR-RD-causing- Undef
varying clinical consequence- Undef
CBAVD 4735heterozygoteCFTR-RD-causing- Undef
CFTR-RD-causing- Undef
varying clinical consequence- Undef
CBAVD 4729heterozygoteVUS3- Undef
likely CFTR-RD- Undef
CBAVD 781heterozygoteVUS3- Undef
CBAVD 858heterozygote
CBAVD 941heterozygoteVUS4- Undef
CF-causing- Undef
CBAVD 887heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 938heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 892heterozygoteCFTR-RD-causing- Undef
varying clinical consequence- Undef
CFTR-RD-causing- Undef
CFTR-RD-causing- Undef
CBAVD 900heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 927heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CFTR-RD-causing- Undef
CBAVD 4710heterozygoteCFTR-RD-causing- Undef
VUS3- Undef
CF-causing- Undef
CBAVD 1469heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
VUS3- Undef
CBAVD 912heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 857heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 856heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 978heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 812heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 986heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 818heterozygote
CBAVD 834heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 949heterozygoteVUS3- Undef
CF-causing- Undef
CBAVD 840heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 805heterozygoteVUS1- Undef
CBAVD 919homozygotec.1210-34_1210-6TG[11]T[5] - Trans
c.1684G>A - p.(Val562Ile) - Trans
c.3846G>A - p.(Trp1282*) - Trans
CBAVD 5129homozygotec.1519_1521del - p.(Ile507del) - Trans
c.1704G>T - p.(Leu568Phe) - Trans
CBAVD 5235homozygotec.1521_1523del - p.(Phe508del) - Trans
c.377G>A - p.(Gly126Asp) - Trans
CBAVD 881homozygotec.1210-34_1210-6TG[11]T[5] - Trans
c.617T>G - p.(Leu206Trp) - Trans
CBAVD 908homozygotec.1210-34_1210-6TG[11]T[5] - Trans
c.1466C>T - p.(Ser489Leu) - Trans
c.1684G>A - p.(Val562Ile) - Trans
CBAVD 720homozygotec.4097T>C - p.(Ile1366Thr) - Trans
CBAVD 725homozygotec.1210-34_1210-6TG[11]T[5] - Trans
c.1684G>A - p.(Val562Ile) - Trans
c.3846G>A - p.(Trp1282*) - Trans
Pending (NBS) 4654heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Pending (NBS) 4631heterozygotevarying clinical consequence- Undef
CF-causing- Undef
Pending (NBS) 4643heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
Pending (NBS) 5808heterozygoteCF-causing- Undef
VUS3- Undef
Pending (NBS) 5247heterozygoteVUS3- Undef
VUS3- Undef
CF-causing- Undef
VUS1- Undef
Pending (NBS) 5769heterozygoteCF-causing- Undef
varying clinical consequence- Undef
VUS3- Undef
Pending (NBS) 5342heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Pending (NBS) 4645heterozygoteCF-causing- Undef
VUS3- Undef
Pending (NBS) 991heterozygoteCFTR-RD-causing- Undef
varying clinical consequence- Undef
CFTR-RD-causing- Undef
Pending (NBS) 4694heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
Pending (NBS) 794heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Pending (NBS) 803heterozygoteVUS2- Undef
CF-causing- Undef
Pending (NBS) 799heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Pending (NBS) 4644homozygotec.1209G>C - p.(Glu403Asp) - Trans
c.2657+5G>A - p.(=) - Trans
Pending (NBS) 5071homozygotec.-288G>C - p.(=) - Trans
c.2657+5G>A - p.(=) - Trans
c.3139+89T>C - p.(=) - Trans
Pancreatitis 4659heterozygoteVUS3- Undef
Pancreatitis 3259heterozygotevarying clinical consequence- Undef
CF-causing- Undef
Pancreatitis 4619heterozygoteVUS3- Undef
VUS3- Undef
Pancreatitis 4849heterozygoteCF-causing - Cis
CF-causing - Trans
Pancreatitis 5621heterozygoteCFTR-RD-causing- Undef
Pancreatitis 5619heterozygoteVUS3- Undef
Pancreatitis 5617heterozygoteVUS3- Undef
Pancreatitis 5614heterozygoteVUS3- Undef
Pancreatitis 5611heterozygoteCFTR-RD-causing- Undef
VUS3- Undef
Pancreatitis 5605heterozygoteVUS2- Undef
Pancreatitis 5974heterozygoteVUS3- Undef
Pancreatitis 5977heterozygoteVUS3- Undef
Pancreatitis 5364heterozygoteVUS3- Undef
Pancreatitis 5340heterozygoteCFTR-RD-causing- Undef
VUS3- Undef
Pancreatitis 5336heterozygoteVUS3- Undef
VUS3- Undef
Pancreatitis 5155heterozygoteCFTR-RD-causing- Undef
VUS3- Undef
VUS3- Undef
Pancreatitis 5165heterozygoteVUS3- Undef
VUS3- Undef
Pancreatitis 669heterozygoteCF-causing- Undef
Pancreatitis 648heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Pancreatitis 4708heterozygoteVUS3- Undef
VUS3- Undef
Pancreatitis 5171homozygotec.-461A>G - p.(=) - Trans
c.980T>G - p.(Leu327Arg) - Trans
Bronchiectasis 4870heterozygoteCFTR-RD-causing- Undef
VUS3- Undef
CFTR-RD-causing- Undef
Bronchiectasis 4657heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Bronchiectasis 4848heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Bronchiectasis 5624heterozygoteVUS3- Undef
CF-causing- Undef
Bronchiectasis 5972heterozygoteVUS3- Undef
varying clinical consequence- Undef
Bronchiectasis 693heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
VUS1- Undef
Bronchiectasis 4725heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
Bronchiectasis 4726heterozygoteCFTR-RD-causing- Undef
varying clinical consequence- Undef
Bronchiectasis 5126homozygotec.1327G>T - p.(Asp443Tyr) - Trans
c.2002C>T - p.(Arg668Cys) - Trans
Bronchiectasis 966homozygotec.1585-9418T>C - p.(=) - Trans
c.899C>A - p.(Ala300Asp) - Trans
Bronchiectasis 5074homozygotec.1210-34_1210-6TG[11]T[5] - Trans
Bronchiectasis 5076homozygotec.2658-77T>A - p.(=) - Trans
Bronchiectasis 777homozygotec.1210-34_1210-6TG[11]T[5] - Trans
c.1684G>A - p.(Val562Ile) - Trans
Asymptomatic compound heterozygote 4617heterozygoteVUS3 - Cis
CF-causing - Trans
Asymptomatic compound heterozygote 4628heterozygoteVUS3- Undef
CFTR-RD-causing- Undef
Asymptomatic compound heterozygote 5140heterozygoteVUS3- Undef
CF-causing- Undef
Asymptomatic compound heterozygote 5141heterozygoteCFTR-RD-causing- Undef
VUS3- Undef
Asymptomatic compound heterozygote 5220heterozygoteVUS3- Undef
non-CF- Undef
Asymptomatic compound heterozygote 5133heterozygoteCFTR-RD-causing- Undef
VUS3- Undef
Asymptomatic compound heterozygote 5606heterozygoteVUS3- Undef
non-CF- Undef
CF-causing- Undef
Asymptomatic compound heterozygote 5964heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CFTR-RD-causing- Undef
Asymptomatic compound heterozygote 4763heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
Asymptomatic compound heterozygote 5077heterozygoteVUS3- Undef
CFTR-RD-causing- Undef
Asymptomatic compound heterozygote 5081heterozygoteCFTR-RD-causing- Undef
Asymptomatic compound heterozygote 5073heterozygoteCFTR-RD-causing- Undef
Asymptomatic compound heterozygote 5362homozygotec.1696G>A - p.(Ala566Thr) - Trans
c.2743G>C - p.(Val915Leu) - Trans
Asymptomatic compound heterozygote 5218homozygotec.1210-34_1210-6TG[11]T[5] - Trans
c.2758G>T - p.(Val920Leu) - Trans
c.3409A>G - p.(Met1137Val) - Trans
Asymptomatic compound heterozygote 4741homozygotec.3154T>G - p.(Phe1052Val) - Trans
c.489+3A>G - p.(=) - Trans
Asymptomatic compound heterozygote 5745homozygotec.1210-34_1210-6TG[11]T[5] - Trans
c.3256A>G - p.(Thr1086Ala) - Trans
Asymptomatic compound heterozygote 5167homozygotec.3718-2477C>T - p.(=) - Trans
Pending non-CF 4825heterozygoteCFTR-RD-causing- Undef
CFTR-RD-causing- Undef
varying clinical consequence- Undef
CRS-NP 5138heterozygoteCFTR-RD-causing- Undef
VUS3- Undef
CRS-NP 5531heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
VUS3- Undef
Aquagenic palmoplantar keratoderma 5822heterozygoteVUS3- Undef
non-CF- Undef
Aquagenic palmoplantar keratoderma 5613heterozygotenon-CF- Undef
Aquagenic palmoplantar keratoderma 4660homozygotec.2002C>T - p.(Arg668Cys) - Trans
c.2657+5G>A - p.(=) - Trans
Aquagenic palmoplantar keratoderma 5149homozygotec.1210-34_1210-6TG[11]T[5] - Trans
c.1521_1523del - p.(Phe508del) - Trans
Aquagenic palmoplantar keratoderma 5772homozygotec.4139C>T - p.(Thr1380Ile) - Trans


Color code:   non disease-causing <   likely benign <   VUS <   likely pathogenic <   disease-causing



            CFTR variants are clustered into five groups:
  • CF-causing: when in trans with another CF-causing mutation, will result in CF.
  • CFTR-RD causing: when in trans with a CF-causing mutation, will result in CFTR-related disorders (CFTR-RD) such as chronic pancreatitis, bronchiectasis, CRS-NP (chronic rhinosinusitis with or without nasal polyposis) or CBAVD (congenital absence of vas deferens), according to Bombieri C et al., 2011.
  • Varying clinical consequence: when in trans with another CF-causing mutation, can either result in CF or in a CFTR-RD.
  • Non disease-causing: when in trans with a CF-causing mutation, will not cause CF, nor CFTR-RD.
  • VUS (Variant of unknown clinical significance): unclassified because of insufficient data.



Go to CFTRare