2018-01-09 | class changed from unclassified to non disease-causing (found in 50% of patients in Montpellier) |
Variant NM_000492.4:c.2619+86_2619+87del
Name | NM_000492.4:c.2619+86_2619+87del |
Protein name | NP_000483.3:p.(=) |
Genomic name (hg19) | chr7:g.117235198_117235199del UCSC |
Genomic name (hg38) | chr7:g.117595144_117595145del UCSC |
#Exon/intron | intron 15 |
Class | non disease-causing |
WT sequence | ATGTATACATATATATGCACACACA TA AATATGTATATATACACATGTATAC |
Mutant sequence | ATGTATACATATATATGCACACACA -- AATATGTATATATACACATGTATAC |
![]() Not found | ![]() Not found | dbSNP no rs |
![]() Not found | ![]() |
No patient found in CFTR-NGS catalogue |
TOTAL NUMBER OF PATIENTS | 158 |
---|---|
Asymptomatic compound heterozygote | 20 |
CF | 24 |
CFTR-RD | 96
|
Fetal bowel anomalies | 1 |
Pending | 1 |
Pending (NBS) | 14 |
Pending non-CF | 2 |
Color code: non disease-causing < likely benign < VUS < likely pathogenic < disease-causing |
Phenotype | Patient ID | Variant status | Additional variants |
---|---|---|---|
Other | 6438 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef VUS3- Undef |
Other | 5175 | heterozygote | CF-causing- Undef VUS3- Undef |
Other | 5775 | heterozygote | CF-causing- Undef VUS3- Undef VUS3- Undef |
Other | 5616 | heterozygote | CFTR-RD-causing- Undef non-CF- Undef |
Other | 5823 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef non-CF- Undef VUS3- Undef |
Other | 5825 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
Other | 4835 | heterozygote | CFTR-RD-causing- Undef VUS3- Undef |
Other | 5243 | heterozygote | VUS3- Undef |
Other | 5743 | heterozygote | CF-causing- Undef VUS3- Undef CFTR-RD-causing- Undef |
Other | 5087 | heterozygote | CFTR-RD-causing- Undef VUS3- Undef |
Other | 4826 | heterozygote | CFTR-RD-causing- Undef CFTR-RD-causing- Undef |
Other | 4698 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
Other | 4625 | homozygote | c.721G>T - p.(Gly241Trp) - Trans |
Other | 5967 | homozygote | c.2780T>C - p.(Leu927Pro) - Trans c.870-1113_870-1110del - p.(=) - Trans |
Other | 4760 | homozygote | c.1163C>T - p.(Thr388Met) - Trans |
CF | 6441 | heterozygote | CF-causing- Undef CF-causing- Undef |
CF | 6453 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
CF | 6456 | heterozygote | CF-causing- Undef varying clinical consequence- Undef VUS3- Undef |
CF | 5971 | heterozygote | CF-causing- Undef VUS3- Undef |
CF | 6432 | heterozygote | VUS3- Undef CF-causing- Undef |
CF | 4765 | heterozygote | VUS3- Undef varying clinical consequence- Undef CF-causing- Undef |
CF | 4744 | heterozygote | CF-causing- Undef VUS3- Undef |
CF | 4747 | heterozygote | CF-causing- Undef CF-causing- Undef |
CF | 5174 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
CF | 5345 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
CF | 5622 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
CF | 5770 | heterozygote | VUS3- Undef CF-causing- Undef |
CF | 5948 | heterozygote | CF-causing- Undef CF-causing- Undef |
CF | 5965 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
CF | 5777 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef VUS3- Undef |
CF | 5328 | heterozygote | CF-causing- Undef CF-causing- Undef |
CF | 5215 | heterozygote | CFTR-RD-causing- Undef VUS3- Undef |
CF | 5067 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
CF | 4629 | heterozygote | CF-causing- Undef CF-causing- Undef VUS1- Undef |
CF | 4697 | heterozygote | CF-causing- Undef CF-causing- Undef |
CF | 4718 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
CF | 5016 | homozygote | c.3909C>G - p.(Asn1303Lys) - Trans c.870-1113_870-1110del - p.(=) - Trans |
CF | 5069 | homozygote | c.1393-1G>A - p.(=) - Trans c.1680-981T>C - p.(=) - Trans c.3874-4522A>G - p.(=) - Trans |
CF | 5341 | homozygote | c.296C>G - p.(Pro99Arg) - Trans c.3846G>A - p.(Trp1282*) - Trans |
CBAVD | 6454 | heterozygote | CFTR-RD-causing- Undef non-CF- Undef CFTR-RD-causing- Undef |
CBAVD | 6455 | heterozygote | CF-causing- Undef VUS3- Undef |
CBAVD | 6458 | heterozygote | VUS3- Undef CF-causing- Undef |
CBAVD | 4750 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef |
CBAVD | 5173 | heterozygote | CF-causing- Undef varying clinical consequence- Undef VUS3- Undef |
CBAVD | 5343 | heterozygote | VUS3- Undef VUS3- Undef |
CBAVD | 5346 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef |
CBAVD | 5944 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef |
CBAVD | 5943 | heterozygote | VUS3- Undef CF-causing- Undef |
CBAVD | 5946 | heterozygote | CF-causing- Undef VUS3- Undef |
CBAVD | 5947 | heterozygote | VUS3- Undef CF-causing- Undef |
CBAVD | 5768 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef |
CBAVD | 5765 | heterozygote | varying clinical consequence- Undef CF-causing- Undef |
CBAVD | 5610 | heterozygote | VUS3- Undef CF-causing- Undef |
CBAVD | 4653 | heterozygote | CFTR-RD-causing- Undef varying clinical consequence- Undef |
CBAVD | 4651 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef VUS1- Undef |
CBAVD | 4663 | heterozygote | varying clinical consequence- Undef CF-causing- Undef |
CBAVD | 4756 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef |
CBAVD | 4761 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
CBAVD | 4837 | heterozygote | CFTR-RD-causing- Undef varying clinical consequence- Undef |
CBAVD | 5821 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
CBAVD | 5022 | heterozygote | CFTR-RD-causing- Undef CFTR-RD-causing- Undef VUS3- Undef varying clinical consequence- Undef |
CBAVD | 5068 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
CBAVD | 4710 | heterozygote | CFTR-RD-causing- Undef VUS3- Undef CF-causing- Undef |
CBAVD | 4706 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef |
CBAVD | 4735 | heterozygote | VUS3- Undef varying clinical consequence- Undef |
CBAVD | 4729 | heterozygote | VUS3- Undef likely CFTR-RD- Undef |
CBAVD | 4752 | heterozygote | VUS3- Undef CF-causing- Undef |
CBAVD | 5766 | homozygote | c.1210-34_1210-6TG[13]T[5] - Trans c.350G>A - p.(Arg117His) - Trans |
CBAVD | 5945 | homozygote | c.1657C>T - p.(Arg553*) - Trans c.350G>A - p.(Arg117His) - Trans |
CBAVD | 5330 | homozygote | c.1521_1523del - p.(Phe508del) - Trans c.349C>G - p.(Arg117Gly) - Trans |
CBAVD | 4646 | homozygote | c.1327G>T - p.(Asp443Tyr) - Trans c.680T>G - p.(Leu227Arg) - Trans |
CBAVD | 5325 | homozygote | c.1210-34_1210-6TG[13]T[5] - Trans c.769G>T - p.(Glu257*) - Trans |
CBAVD | 5314 | homozygote | c.1210-34_1210-6TG[11]T[5] - Trans c.2195T>G - p.(Leu732*) - Trans |
Pancreatitis | 5977 | heterozygote | VUS3- Undef |
Pancreatitis | 5165 | heterozygote | VUS3- Undef VUS3- Undef |
Pancreatitis | 5974 | heterozygote | VUS3- Undef |
Pancreatitis | 5973 | heterozygote | VUS3- Undef VUS3- Undef |
Pancreatitis | 5171 | heterozygote | VUS3- Undef VUS3- Undef |
Pancreatitis | 5155 | heterozygote | VUS3- Undef VUS3- Undef |
Pancreatitis | 5621 | heterozygote | |
Pancreatitis | 5949 | heterozygote | varying clinical consequence- Undef CF-causing- Undef |
Pancreatitis | 5619 | heterozygote | VUS3- Undef |
Pancreatitis | 5329 | heterozygote | varying clinical consequence- Undef |
Pancreatitis | 5336 | heterozygote | VUS3- Undef VUS3- Undef |
Pancreatitis | 5339 | heterozygote | varying clinical consequence- Undef CFTR-RD-causing- Undef |
Pancreatitis | 5340 | heterozygote | VUS3- Undef |
Pancreatitis | 5605 | heterozygote | VUS2- Undef |
Pancreatitis | 5608 | heterozygote | VUS3- Undef |
Pancreatitis | 5614 | heterozygote | VUS3- Undef |
Pancreatitis | 5070 | heterozygote | CFTR-RD-causing- Undef non-CF- Undef |
Pancreatitis | 4639 | heterozygote | VUS3- Undef VUS3- Undef |
Pancreatitis | 4642 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef |
Pancreatitis | 4659 | heterozygote | VUS3- Undef |
Pancreatitis | 4708 | heterozygote | CFTR-RD-causing- Undef VUS3- Undef |
Pancreatitis | 4619 | heterozygote | CFTR-RD-causing- Undef VUS3- Undef |
Pancreatitis | 4743 | homozygote | c.1521_1523del - p.(Phe508del) - Trans c.350G>A - p.(Arg117His) - Trans |
Pancreatitis | 5364 | homozygote | c.3340G>C - p.(Val1114Leu) - Trans |
Pancreatitis | 5332 | homozygote | |
Pancreatitis | 5154 | homozygote | c.350G>A - p.(Arg117His) - Trans c.509G>A - p.(Arg170His) - Trans |
Bronchiectasis | 5005 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef |
Bronchiectasis | 5624 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
Bronchiectasis | 5331 | heterozygote | VUS3- Undef |
Bronchiectasis | 5126 | heterozygote | VUS3- Undef |
Bronchiectasis | 5074 | heterozygote | CFTR-RD-causing - Cis CFTR-RD-causing - Trans |
Bronchiectasis | 4657 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
Bronchiectasis | 4623 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
Bronchiectasis | 4726 | heterozygote | CFTR-RD-causing- Undef varying clinical consequence- Undef |
Bronchiectasis | 4725 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef |
Bronchiectasis | 6435 | homozygote | c.1210-34_1210-6TG[11]T[5] - Trans c.870-1113_870-1110del - p.(=) - Trans |
Bronchiectasis | 5972 | homozygote | c.1210-34_1210-6TG[11]T[5] - Trans c.870-1113_870-1110del - p.(=) - Trans |
Bronchiectasis | 6436 | homozygote | c.3303G>A - p.(Met1101Ile) - Trans |
Fetal bowel anomalies | 4738 | heterozygote | CFTR-RD-causing- Undef |
Asymptomatic compound heterozygote | 4763 | heterozygote | CF-causing- Undef |
Asymptomatic compound heterozygote | 6434 | heterozygote | CFTR-RD-causing- Undef VUS3- Undef |
Asymptomatic compound heterozygote | 6440 | heterozygote | varying clinical consequence- Undef CF-causing- Undef |
Asymptomatic compound heterozygote | 5167 | heterozygote | varying clinical consequence- Undef |
Asymptomatic compound heterozygote | 6437 | heterozygote | CFTR-RD-causing- Undef VUS3- Undef |
Asymptomatic compound heterozygote | 5964 | heterozygote | VUS3- Undef CF-causing- Undef |
Asymptomatic compound heterozygote | 5333 | heterozygote | non-CF- Undef CFTR-RD-causing- Undef |
Asymptomatic compound heterozygote | 5164 | heterozygote | CF-causing- Undef |
Asymptomatic compound heterozygote | 5073 | heterozygote | |
Asymptomatic compound heterozygote | 5144 | heterozygote | VUS3- Undef VUS1- Undef |
Asymptomatic compound heterozygote | 5140 | heterozygote | VUS3- Undef CF-causing- Undef |
Asymptomatic compound heterozygote | 5077 | heterozygote | VUS3- Undef |
Asymptomatic compound heterozygote | 4656 | heterozygote | VUS3- Undef VUS3- Undef |
Asymptomatic compound heterozygote | 4628 | heterozygote | VUS3- Undef CFTR-RD-causing- Undef |
Asymptomatic compound heterozygote | 5081 | homozygote | |
Asymptomatic compound heterozygote | 5141 | homozygote | c.2756A>G - p.(Tyr919Cys) - Trans |
Asymptomatic compound heterozygote | 4741 | homozygote | c.489+3A>G - p.(=) - Trans |
Asymptomatic compound heterozygote | 5177 | homozygote | c.2756A>G - p.(Tyr919Cys) - Trans |
Asymptomatic compound heterozygote | 5525 | homozygote | c.4275T>A - p.(Asp1425Glu) - Trans |
Asymptomatic compound heterozygote | 5818 | homozygote | c.1210-34_1210-6TG[11]T[5] - Trans |
Pending non-CF | 4825 | heterozygote | VUS3- Undef varying clinical consequence- Undef |
Pending non-CF | 5009 | heterozygote | VUS3- Undef CF-causing- Undef |
CRS-NP | 5138 | heterozygote | VUS3- Undef |
CRS-NP | 4649 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
CRS-NP | 6442 | heterozygote | CFTR-RD-causing- Undef VUS3- Undef |
CRS-NP | 5338 | heterozygote | CFTR-RD-causing- Undef non-CF- Undef |
Pending (NBS) | 6457 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
Pending (NBS) | 5951 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
Pending (NBS) | 5342 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
Pending (NBS) | 5609 | heterozygote | VUS3- Undef CF-causing- Undef |
Pending (NBS) | 5817 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
Pending (NBS) | 5820 | heterozygote | CF-causing- Undef VUS3- Undef CFTR-RD-causing- Undef |
Pending (NBS) | 4631 | heterozygote | varying clinical consequence- Undef CF-causing- Undef |
Pending (NBS) | 4654 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
Pending (NBS) | 5017 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef |
Pending (NBS) | 4616 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef |
Pending (NBS) | 4643 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef |
Pending (NBS) | 4620 | heterozygote | varying clinical consequence- Undef CF-causing- Undef |
Pending (NBS) | 4644 | homozygote | c.1209G>C - p.(Glu403Asp) - Trans c.2657+5G>A - p.(=) - Trans |
Pending (NBS) | 4645 | homozygote | c.1000C>T - p.(Arg334Trp) - Trans c.490A>C - p.(Thr164Pro) - Trans |
Aquagenic palmoplantar keratoderma | 5822 | heterozygote | CFTR-RD-causing- Undef non-CF- Undef |
Aquagenic palmoplantar keratoderma | 5149 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
Aquagenic palmoplantar keratoderma | 5613 | heterozygote | non-CF- Undef |
Aquagenic palmoplantar keratoderma | 4660 | homozygote | c.2657+5G>A - p.(=) - Trans |
Aquagenic palmoplantar keratoderma | 5772 | homozygote | c.4139C>T - p.(Thr1380Ile) - Trans |
Pending | 5008 | homozygote | c.2657+5G>A - p.(=) - Trans c.2988+1G>A - p.(=) - Trans |
Color code: non disease-causing < likely benign < VUS < likely pathogenic < disease-causing |
CFTR variants are clustered into five groups: |
|