Variant NM_000492.4:c.2619+86_2619+87del


Variant details:
Name NM_000492.4:c.2619+86_2619+87del
Protein name NP_000483.3:p.(=)
Genomic name (hg19) chr7:g.117235198_117235199del    UCSC    
#Exon/intron intron 15
Class non disease-causing
WT sequence ATGTATACATATATATGCACACACA TA AATATGTATATATACACATGTATAC
Mutant sequence ATGTATACATATATATGCACACACA -- AATATGTATATATACACATGTATAC

Other databases:

Not found
Not found		dbSNP
no rs







Pathogenicity predictors:

Not found





No patient found in CFTR-NGS catalogue


143 patients carrying this variant are reported in CFTR-France:

TOTAL NUMBER OF PATIENTS 143
Asymptomatic compound heterozygote 17
CF 20
CFTR-RD89
  • Aquagenic palmoplantar keratoderma  5
  • Bronchiectasis  10
  • CBAVD  31
  • CRS-NP  3
  • Other  14
  • Pancreatitis  26
Fetal bowel anomalies 1
Pending 1
Pending (NBS) 13
Pending non-CF 2




Color code:   non disease-causing <   likely benign <   VUS <   likely pathogenic <   disease-causing

Detailed genotypes:
Phenotype Patient ID Variant status Additional variants
Other 5175heterozygoteCF-causing- Undef
VUS3- Undef
Other 5775heterozygoteCF-causing- Undef
VUS3- Undef
VUS3- Undef
Other 5616heterozygoteCFTR-RD-causing- Undef
non-CF- Undef
Other 4698heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Other 4826heterozygoteVUS3- Undef
CFTR-RD-causing- Undef
Other 5087heterozygoteVUS3- Undef
VUS3- Undef
Other 5243heterozygoteVUS3- Undef
Other 5743heterozygoteCF-causing- Undef
VUS3- Undef
CFTR-RD-causing- Undef
Other 5823heterozygoteVUS3- Undef
CF-causing- Undef
non-CF- Undef
VUS3- Undef
Other 4835heterozygoteCFTR-RD-causing- Undef
VUS3- Undef
Other 5825heterozygoteVUS3- Undef
CF-causing- Undef
Other 4625homozygotec.721G>T - p.(Gly241Trp) - Trans
Other 5967homozygotec.2780T>C - p.(Leu927Pro) - Trans
c.870-1113_870-1110del - p.(=) - Trans
Other 4760homozygotec.1163C>T - p.(Thr388Met) - Trans
CF 5971heterozygoteCF-causing- Undef
VUS3- Undef
CF 5328heterozygoteCF-causing- Undef
CF-causing- Undef
CF 5345heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 4765heterozygoteVUS3- Undef
varying clinical consequence- Undef
CF-causing- Undef
CF 4744heterozygoteCF-causing- Undef
VUS3- Undef
CF 4747heterozygoteCF-causing- Undef
CF-causing- Undef
CF 5174heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 5770heterozygoteVUS3- Undef
CF-causing- Undef
CF 5948heterozygoteCF-causing- Undef
CF-causing- Undef
CF 5965heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 5777heterozygoteVUS3- Undef
CF-causing- Undef
VUS3- Undef
CF 5622heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 5215heterozygoteVUS3- Undef
CFTR-RD-causing- Undef
CFTR-RD-causing- Undef
CF 4697heterozygoteCF-causing- Undef
CF-causing- Undef
CF 4718heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 5067heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 4629heterozygoteCF-causing- Undef
CF-causing- Undef
VUS1- Undef
CF 5069homozygotec.1393-1G>A - p.(=) - Trans
c.1680-981T>C - p.(=) - Trans
c.3874-4522A>G - p.(=) - Trans
CF 5341homozygotec.296C>G - p.(Pro99Arg) - Trans
c.3846G>A - p.(Trp1282*) - Trans
CF 5016homozygotec.3909C>G - p.(Asn1303Lys) - Trans
c.870-1113_870-1110del - p.(=) - Trans
CBAVD 5346heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 5944heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 5343heterozygoteVUS3- Undef
VUS3- Undef
CBAVD 4750heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 5173heterozygoteCF-causing- Undef
varying clinical consequence- Undef
VUS3- Undef
CBAVD 5943heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 5946heterozygoteCF-causing- Undef
VUS3- Undef
CBAVD 5947heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 5768heterozygoteCF-causing- Undef
VUS3- Undef
CBAVD 5610heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 5765heterozygotevarying clinical consequence- Undef
CF-causing- Undef
CBAVD 5821heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 4706heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 4710heterozygoteCFTR-RD-causing- Undef
VUS3- Undef
CF-causing- Undef
CBAVD 4729heterozygoteVUS3- Undef
likely CFTR-RD- Undef
CBAVD 4735heterozygoteCFTR-RD-causing- Undef
CFTR-RD-causing- Undef
varying clinical consequence- Undef
CBAVD 4837heterozygoteCFTR-RD-causing- Undef
varying clinical consequence- Undef
CBAVD 5068heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 4761heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 4752heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 5022heterozygoteVUS3- Undef
CFTR-RD-causing- Undef
VUS3- Undef
varying clinical consequence- Undef
CBAVD 4756heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 4653heterozygoteCFTR-RD-causing- Undef
varying clinical consequence- Undef
CBAVD 4651heterozygoteVUS3- Undef
CF-causing- Undef
VUS1- Undef
CBAVD 4663heterozygotevarying clinical consequence- Undef
CF-causing- Undef
CBAVD 5766homozygotec.1210-34_1210-6TG[13]T[5] - Trans
c.350G>A - p.(Arg117His) - Trans
CBAVD 5945homozygotec.1657C>T - p.(Arg553*) - Trans
c.350G>A - p.(Arg117His) - Trans
CBAVD 5314homozygotec.1210-34_1210-6TG[11]T[5] - Trans
c.2195T>G - p.(Leu732*) - Trans
CBAVD 4646homozygotec.1327G>T - p.(Asp443Tyr) - Trans
c.2002C>T - p.(Arg668Cys) - Trans
c.680T>G - p.(Leu227Arg) - Trans
CBAVD 5325homozygotec.1210-34_1210-6TG[13]T[5] - Trans
c.769G>T - p.(Glu257*) - Trans
CBAVD 5330homozygotec.1521_1523del - p.(Phe508del) - Trans
c.349C>G - p.(Arg117Gly) - Trans
Pancreatitis 5973heterozygoteVUS3- Undef
VUS3- Undef
Pancreatitis 5974heterozygoteVUS3- Undef
Pancreatitis 5977heterozygoteVUS3- Undef
Pancreatitis 5165heterozygoteVUS3- Undef
VUS3- Undef
Pancreatitis 5171heterozygoteVUS3- Undef
VUS3- Undef
Pancreatitis 5155heterozygoteCFTR-RD-causing- Undef
VUS3- Undef
VUS3- Undef
Pancreatitis 5329heterozygotevarying clinical consequence- Undef
Pancreatitis 4642heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
Pancreatitis 4659heterozygoteVUS3- Undef
Pancreatitis 5949heterozygotevarying clinical consequence- Undef
CF-causing- Undef
Pancreatitis 5621heterozygoteCFTR-RD-causing- Undef
Pancreatitis 5619heterozygoteVUS3- Undef
Pancreatitis 5336heterozygoteVUS3- Undef
VUS3- Undef
Pancreatitis 5339heterozygotevarying clinical consequence- Undef
CFTR-RD-causing- Undef
Pancreatitis 5340heterozygoteCFTR-RD-causing- Undef
VUS3- Undef
Pancreatitis 5605heterozygoteVUS2- Undef
Pancreatitis 5608heterozygoteVUS3- Undef
Pancreatitis 5614heterozygoteVUS3- Undef
Pancreatitis 4639heterozygoteVUS3- Undef
VUS3- Undef
Pancreatitis 5070heterozygoteCFTR-RD-causing- Undef
non-CF- Undef
Pancreatitis 4708heterozygoteVUS3- Undef
VUS3- Undef
Pancreatitis 4619heterozygoteVUS3- Undef
VUS3- Undef
Pancreatitis 5154homozygotec.350G>A - p.(Arg117His) - Trans
c.509G>A - p.(Arg170His) - Trans
Pancreatitis 5332homozygote
Pancreatitis 5364homozygotec.3340G>C - p.(Val1114Leu) - Trans
Pancreatitis 4743homozygotec.1521_1523del - p.(Phe508del) - Trans
c.350G>A - p.(Arg117His) - Trans
Bronchiectasis 4657heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Bronchiectasis 5005heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
Bronchiectasis 5331heterozygoteVUS3- Undef
Bronchiectasis 5624heterozygoteVUS3- Undef
CF-causing- Undef
Bronchiectasis 5126heterozygoteCFTR-RD-causing- Undef
CFTR-RD-causing- Undef
Bronchiectasis 4725heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
Bronchiectasis 4726heterozygoteCFTR-RD-causing- Undef
varying clinical consequence- Undef
Bronchiectasis 5074heterozygoteVUS3 - Cis
VUS3 - Trans
Bronchiectasis 4623heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Bronchiectasis 5972homozygotec.1210-34_1210-6TG[11]T[5] - Trans
c.870-1113_870-1110del - p.(=) - Trans
Fetal bowel anomalies 4738heterozygoteVUS3- Undef
Asymptomatic compound heterozygote 5167heterozygotevarying clinical consequence- Undef
Asymptomatic compound heterozygote 4656heterozygoteVUS3- Undef
VUS3- Undef
Asymptomatic compound heterozygote 4763heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
Asymptomatic compound heterozygote 5333heterozygotenon-CF- Undef
CFTR-RD-causing- Undef
Asymptomatic compound heterozygote 5964heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CFTR-RD-causing- Undef
Asymptomatic compound heterozygote 5164heterozygoteCF-causing- Undef
Asymptomatic compound heterozygote 5144heterozygoteVUS3- Undef
VUS1- Undef
Asymptomatic compound heterozygote 5140heterozygoteVUS3- Undef
CF-causing- Undef
Asymptomatic compound heterozygote 5077heterozygoteVUS3- Undef
CFTR-RD-causing- Undef
Asymptomatic compound heterozygote 5073heterozygoteCFTR-RD-causing- Undef
Asymptomatic compound heterozygote 4628heterozygoteVUS3- Undef
CFTR-RD-causing- Undef
Asymptomatic compound heterozygote 5081homozygotec.2002C>T - p.(Arg668Cys) - Trans
Asymptomatic compound heterozygote 4741homozygotec.3154T>G - p.(Phe1052Val) - Trans
c.489+3A>G - p.(=) - Trans
Asymptomatic compound heterozygote 5818homozygotec.1210-34_1210-6TG[11]T[5] - Trans
Asymptomatic compound heterozygote 5525homozygotec.4275T>A - p.(Asp1425Glu) - Trans
c.91C>T - p.(Arg31Cys) - Trans
Asymptomatic compound heterozygote 5177homozygotec.2756A>G - p.(Tyr919Cys) - Trans
Asymptomatic compound heterozygote 5141homozygotec.2002C>T - p.(Arg668Cys) - Trans
c.2756A>G - p.(Tyr919Cys) - Trans
Pending non-CF 4825heterozygoteCFTR-RD-causing- Undef
CFTR-RD-causing- Undef
varying clinical consequence- Undef
Pending non-CF 5009heterozygoteVUS3- Undef
CF-causing- Undef
CRS-NP 5138heterozygoteCFTR-RD-causing- Undef
VUS3- Undef
CRS-NP 4649heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CRS-NP 5338heterozygoteCFTR-RD-causing- Undef
non-CF- Undef
Pending (NBS) 4654heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Pending (NBS) 5951heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Pending (NBS) 5342heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Pending (NBS) 5609heterozygoteVUS3- Undef
CF-causing- Undef
Pending (NBS) 5820heterozygoteCF-causing- Undef
VUS3- Undef
CFTR-RD-causing- Undef
Pending (NBS) 5817heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Pending (NBS) 4616heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
Pending (NBS) 4643heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
Pending (NBS) 5017heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
Pending (NBS) 4631heterozygotevarying clinical consequence- Undef
CF-causing- Undef
Pending (NBS) 4620heterozygotevarying clinical consequence- Undef
CF-causing- Undef
Pending (NBS) 4644homozygotec.1209G>C - p.(Glu403Asp) - Trans
c.2657+5G>A - p.(=) - Trans
Pending (NBS) 4645homozygotec.1000C>T - p.(Arg334Trp) - Trans
c.490A>C - p.(Thr164Pro) - Trans
Aquagenic palmoplantar keratoderma 5822heterozygoteVUS3- Undef
non-CF- Undef
Aquagenic palmoplantar keratoderma 5149heterozygoteVUS3- Undef
CF-causing- Undef
Aquagenic palmoplantar keratoderma 5613heterozygotenon-CF- Undef
Aquagenic palmoplantar keratoderma 4660homozygotec.2002C>T - p.(Arg668Cys) - Trans
c.2657+5G>A - p.(=) - Trans
Aquagenic palmoplantar keratoderma 5772homozygotec.4139C>T - p.(Thr1380Ile) - Trans
Pending 5008homozygotec.2657+5G>A - p.(=) - Trans
c.2988+1G>A - p.(=) - Trans


Color code:   non disease-causing <   likely benign <   VUS <   likely pathogenic <   disease-causing



            CFTR variants are clustered into five groups:
  • CF-causing: when in trans with another CF-causing mutation, will result in CF.
  • CFTR-RD causing: when in trans with a CF-causing mutation, will result in CFTR-related disorders (CFTR-RD) such as chronic pancreatitis, bronchiectasis, CRS-NP (chronic rhinosinusitis with or without nasal polyposis) or CBAVD (congenital absence of vas deferens), according to Bombieri C et al., 2011.
  • Varying clinical consequence: when in trans with another CF-causing mutation, can either result in CF or in a CFTR-RD.
  • Non disease-causing: when in trans with a CF-causing mutation, will not cause CF, nor CFTR-RD.
  • VUS (Variant of unknown clinical significance): unclassified because of insufficient data.



Go to CFTRare