Variant NM_000492.4:c.4389G>A


Variant details:
Name NM_000492.4:c.4389G>A
Protein name NP_000483.3:p.(=)
Genomic name (hg19)     chr7:g.117307108G>A    UCSC    
Genomic name (hg38) chr7:g.117667054G>A    UCSC
#Exon/intron exon 27
Legacy Name Q1463Q (4521G/A)
Class non disease-causing
WT sequence CAAGCAAGTGCAAGTCTAAGCCCCA G ATTGCTGCTCTGAAAGAGGAGACAG
Mutant sequence CAAGCAAGTGCAAGTCTAAGCCCCA A ATTGCTGCTCTGAAAGAGGAGACAG

Other databases:

Not found
dbSNP
rs1800136







Pathogenicity predictors:

Not found





56 individuals carrying this variant are reported in CFTR-NGS catalogue


520 patients carrying this variant are reported in CFTR-France:

TOTAL NUMBER OF PATIENTS 520
Asymptomatic compound heterozygote 30
CF 130
CFTR-RD317
  • Aquagenic palmoplantar keratoderma  4
  • Bronchiectasis  34
  • CBAVD  154
  • CRS-NP  7
  • Other  48
  • Pancreatitis  70
Pending 6
Pending (NBS) 33
Pending non-CF 4




Color code:   non disease-causing <   likely benign <   VUS <   likely pathogenic <   disease-causing

Detailed genotypes:
Phenotype Patient ID Variant status Additional variants
CF 3021heterozygotevarying clinical consequence - Cis
CF-causing - Trans
CF 3026heterozygoteVUS3 - Cis
CF-causing - Cis
CF-causing - Trans
CF 4633heterozygoteCF-causing- Undef
CF-causing- Undef
CF 4759heterozygoteCF-causing- Undef
CF-causing- Undef
CF 3005heterozygoteCF-causing- Undef
CF-causing- Undef
CF 2999heterozygoteCF-causing- Undef
CF-causing- Undef
CF 2898heterozygoteCF-causing- Undef
CF-causing- Undef
VUS3- Undef
CF 2947heterozygoteCF-causing- Undef
CF-causing- Undef
CF 2962heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 5069heterozygoteCF-causing- Undef
VUS3- Undef
varying clinical consequence- Undef
CF 4629heterozygoteCF-causing- Undef
CF-causing- Undef
VUS1- Undef
CF 3223heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 3097heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 3140heterozygoteCF-causing- Undef
CF-causing- Undef
VUS3- Undef
CF 3193heterozygoteCF-causing - Cis
CF-causing - Trans
CF 3200heterozygoteCF-causing- Undef
CF-causing- Undef
CF 3217heterozygoteCF-causing- Undef
CF-causing- Undef
CF 2888heterozygoteCF-causing- Undef
CF-causing- Undef
CF 2333heterozygoteCF-causing- Undef
CF-causing- Undef
CF 2361heterozygoteCF-causing- Undef
CF-causing- Undef
CF 2442heterozygoteCF-causing- Undef
CF-causing- Undef
CF 2568heterozygoteCF-causing- Undef
CF-causing- Undef
CF 2760heterozygotevarying clinical consequence- Undef
CF-causing- Undef
CF 2761heterozygoteCF-causing- Undef
CF-causing- Undef
CF 2821heterozygotevarying clinical consequence - Cis
CF-causing - Trans
CF 2459heterozygoteCF-causing- Undef
CF-causing- Undef
CF 2495heterozygoteCF-causing- Undef
CF-causing- Undef
CF 2515heterozygoteCF-causing- Undef
CF-causing- Undef
CF 2882heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 3674heterozygoteCF-causing- Undef
CF-causing- Undef
CF 4043heterozygoteCF-causing- Undef
CF-causing- Undef
CF 4237heterozygoteCF-causing- Undef
CF-causing- Undef
CF 4390heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 4553heterozygoteCF-causing- Undef
CF-causing- Undef
CF 4538heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CF-causing- Undef
CF 4535heterozygoteCF-causing- Undef
CF-causing- Undef
CF 4439heterozygoteCF-causing- Undef
CF-causing- Undef
CF 4480heterozygoteCF-causing- Undef
VUS2- Undef
CF 4483heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 4499heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 4502heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 6456heterozygoteCF-causing- Undef
varying clinical consequence- Undef
VUS3- Undef
CF 5328heterozygoteCF-causing- Undef
CF-causing- Undef
CF 6432heterozygoteVUS3- Undef
CF-causing- Undef
CF 4765heterozygoteVUS3- Undef
varying clinical consequence- Undef
CF-causing- Undef
CF 4744heterozygoteCF-causing- Undef
VUS3- Undef
CF 5341heterozygoteVUS3- Undef
CF-causing- Undef
CF 5770heterozygoteVUS3- Undef
CF-causing- Undef
CF 5948heterozygoteCF-causing- Undef
CF-causing- Undef
CF 5965heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 5622heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 5777heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
VUS3- Undef
CF 488heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 466heterozygoteCF-causing- Undef
CF-causing- Undef
VUS3- Undef
CF 654heterozygoteCF-causing- Undef
CF-causing- Undef
CF 570heterozygotevarying clinical consequence- Undef
CF-causing- Undef
CF 579heterozygotevarying clinical consequence- Undef
CF-causing- Undef
CF 586heterozygoteCF-causing- Undef
CF-causing- Undef
CF 596heterozygoteCF-causing- Undef
CF-causing- Undef
CF 597heterozygoteCF-causing- Undef
CF-causing- Undef
CF 611heterozygoteCF-causing- Undef
CF-causing- Undef
CF 617heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 631heterozygoteCF-causing- Undef
CF-causing- Undef
CF 4665heterozygoteVUS3- Undef
CF 86heterozygoteCF-causing- Undef
CF-causing- Undef
CF 90heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 94heterozygoteCF-causing- Undef
CF-causing- Undef
CF 111heterozygotevarying clinical consequence- Undef
CF-causing- Undef
CF 126heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 143heterozygoteCF-causing- Undef
CF-causing- Undef
CF 156heterozygotevarying clinical consequence- Undef
CF-causing- Undef
CF 169heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 175heterozygoteCF-causing- Undef
CF-causing- Undef
CF 203heterozygoteCF-causing- Undef
CF-causing- Undef
CF 4697heterozygoteCF-causing- Undef
CF-causing- Undef
CF 4718heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 348heterozygoteCF-causing- Undef
CF-causing- Undef
CF 350heterozygoteCF-causing- Undef
CF-causing- Undef
CF 351heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 359heterozygoteCF-causing- Undef
CF-causing- Undef
VUS3- Undef
CF 361heterozygoteCF-causing- Undef
CF-causing- Undef
CF 369heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 379heterozygoteCF-causing- Undef
CF-causing- Undef
CF 383heterozygotevarying clinical consequence- Undef
CF-causing- Undef
CF-causing- Undef
CF 384heterozygoteCF-causing- Undef
CF-causing- Undef
CF 341heterozygoteCF-causing- Undef
CF-causing- Undef
CF 335heterozygoteCF-causing- Undef
CF-causing- Undef
CF 236heterozygoteCF-causing- Undef
CF-causing- Undef
CF 245heterozygoteCF-causing- Undef
VUS1- Undef
VUS3- Undef
CF-causing- Undef
CF 247heterozygoteVUS3- Undef
CF-causing- Undef
CF 289heterozygoteCF-causing- Undef
likely CF- Undef
CF 294heterozygoteVUS1- Undef
CF 305heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CF 322heterozygoteCF-causing- Undef
CF-causing- Undef
CF 326heterozygotevarying clinical consequence- Undef
CF-causing- Undef
CF 330heterozygoteCF-causing - Cis
CF-causing - Trans
CF 1071heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 4785heterozygotevarying clinical consequence- Undef
CF-causing- Undef
CF 4780heterozygoteCF-causing- Undef
CF-causing- Undef
CF 4782heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 4867heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CF 4858heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 4854heterozygoteCF-causing- Undef
CF-causing- Undef
CF 1561heterozygoteCF-causing- Undef
CF-causing- Undef
CF 1581heterozygoteCF-causing- Undef
CF-causing- Undef
CF 1932heterozygoteCF-causing- Undef
CF-causing- Undef
CF 1320heterozygoteCF-causing- Undef
CF-causing- Undef
CF 1125heterozygoteCF-causing- Undef
CF-causing- Undef
CF 1128heterozygotevarying clinical consequence- Undef
CF-causing- Undef
CF 1138heterozygoteCF-causing- Undef
CF-causing- Undef
CF 1139heterozygoteCF-causing- Undef
CF-causing- Undef
CF 1170heterozygoteCF-causing- Undef
CF-causing- Undef
CF 1178heterozygoteCF-causing- Undef
CF-causing- Undef
CF 745heterozygoteCF-causing- Undef
CF-causing- Undef
CF 920heterozygoteVUS2- Undef
CF-causing- Undef
CF-causing- Undef
CF 816heterozygoteCF-causing- Undef
CF-causing- Undef
CF 829heterozygoteCF-causing- Undef
varying clinical consequence- Undef
VUS3- Undef
CF 1005heterozygoteCF-causing- Undef
CF-causing- Undef
CF 5807heterozygoteCF-causing- Undef
VUS3- Undef
CF 5215heterozygoteCFTR-RD-causing- Undef
VUS3- Undef
CF 1006heterozygoteCF-causing- Undef
CF-causing- Undef
CF 945heterozygoteCF-causing- Undef
CF-causing- Undef
CF 4688homozygotec.1519_1521del - p.(Ile507del) - Trans
c.2657+5G>A - p.(=) - Trans
CF 730homozygotec.3131A>G - p.(Glu1044Gly) - Trans
CF 1517homozygotec.2604A>G - p.(=) - Trans
c.2805_2810delinsTCAGA - p.(Pro936Glnfs*6) - Trans
c.3196C>T - p.(Arg1066Cys) - Trans
CF 901homozygotec.2657+5G>A - p.(=) - Trans
CF 5188homozygotec.1792A>T - p.(Lys598*) - Trans
CF 882homozygotec.1518C>G - p.(Ile506Met) - Trans
c.1521_1523del - p.(Phe508del) - Trans
CF 153homozygotec.1519_1521del - p.(Ile507del) - Trans
c.861_865del - p.(Asn287Lysfs*19) - Trans
CF 177homozygotec.2988+1G>A - p.(=) - Trans
c.54-1161_164+1603del - p.(Ser18_Glu54del) - Trans
Other 3047heterozygoteCF-causing- Undef
Other 4760heterozygoteVUS3- Undef
Other 2906heterozygotevarying clinical consequence - Cis
CFTR-RD-causing - Trans
Other 4625heterozygoteVUS3- Undef
Other 3247heterozygotevarying clinical consequence- Undef
CF-causing- Undef
Other 2433heterozygoteVUS3- Undef
Other 2434heterozygoteCF-causing- Undef
Other 2544heterozygotevarying clinical consequence- Undef
CF-causing- Undef
Other 2696heterozygoteCFTR-RD-causing- Undef
varying clinical consequence- Undef
Other 5575heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Other 3660heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Other 4293heterozygote
Other 4312heterozygoteCF-causing- Undef
VUS2- Undef
Other 4315heterozygotevarying clinical consequence- Undef
Other 4317heterozygoteCF-causing- Undef
Other 4278heterozygoteVUS3- Undef
CF-causing- Undef
VUS1- Undef
Other 4561heterozygoteCF-causing- Undef
non-CF- Undef
Other 4570heterozygoteVUS3- Undef
CF-causing- Undef
Other 4572heterozygoteVUS2- Undef
Other 4520heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Other 4615heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
Other 6438heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
VUS3- Undef
Other 5763heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
non-CF- Undef
Other 5775heterozygoteCF-causing- Undef
VUS3- Undef
VUS3- Undef
Other 464heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Other 87heterozygotevarying clinical consequence- Undef
CF-causing- Undef
Other 4835heterozygoteCFTR-RD-causing- Undef
VUS3- Undef
Other 4671heterozygoteVUS3- Undef
Other 4686heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Other 5083heterozygoteVUS3- Undef
CF-causing- Undef
Other 4800heterozygoteVUS3- Undef
CF-causing- Undef
VUS3- Undef
varying clinical consequence- Undef
Other 5184heterozygoteVUS3- Undef
CF-causing- Undef
VUS3- Undef
varying clinical consequence- Undef
Other 5187heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
Other 1089heterozygotevarying clinical consequence - Cis
Other 4783heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Other 5823heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
non-CF- Undef
VUS3- Undef
Other 5825heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Other 1099heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Other 1576heterozygoteCF-causing- Undef
VUS3- Undef
Other 2277heterozygoteCF-causing- Undef
Other 1124heterozygotevarying clinical consequence- Undef
Other 1134heterozygotevarying clinical consequence- Undef
CF-causing- Undef
Other 935heterozygoteCFTR-RD-causing- Undef
Other 940heterozygoteCF-causing- Undef
Other 972heterozygoteCF-causing- Undef
Other 5743heterozygoteCF-causing- Undef
VUS3- Undef
CFTR-RD-causing- Undef
Other 5087heterozygoteCFTR-RD-causing- Undef
VUS3- Undef
Other 5082homozygotec.1116+1G>A - p.(=) - Trans
c.1210-34_1210-6TG[11]T[5] - Trans
CBAVD 4653heterozygoteCFTR-RD-causing- Undef
varying clinical consequence- Undef
CBAVD 3064heterozygoteCF-causing - Cis
CFTR-RD-causing - Trans
CBAVD 4651heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
VUS1- Undef
CBAVD 4756heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 4752heterozygoteVUS3- Undef
CF-causing- Undef
CBAVD 5022heterozygoteCFTR-RD-causing- Undef
CFTR-RD-causing- Undef
VUS3- Undef
varying clinical consequence- Undef
CBAVD 3267heterozygoteVUS3- Undef
CF-causing- Undef
CBAVD 3326heterozygoteCFTR-RD-causing- Undef
CBAVD 3125heterozygoteCF-causing- Undef
VUS1- Undef
varying clinical consequence- Undef
CBAVD 3201heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 2411heterozygote
CBAVD 2421heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 2292heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 5018heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 2853heterozygoteVUS3- Undef
CF-causing- Undef
CBAVD 2525heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 2485heterozygoteVUS3- Undef
CF-causing- Undef
VUS3- Undef
CBAVD 2504heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
VUS1- Undef
CBAVD 4291heterozygoteVUS3- Undef
CBAVD 4311heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 4814heterozygoteCF-causing- Undef
CBAVD 4279heterozygoteVUS3- Undef
CF-causing- Undef
CBAVD 4239heterozygoteCF-causing- Undef
likely CFTR-RD- Undef
CBAVD 4271heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 4419heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 4554heterozygoteVUS4- Undef
CBAVD 4571heterozygoteVUS3- Undef
CF-causing- Undef
CBAVD 4574heterozygoteVUS3- Undef
CF-causing- Undef
CBAVD 4577heterozygoteCFTR-RD-causing- Undef
varying clinical consequence- Undef
CBAVD 4592heterozygoteCFTR-RD-causing- Undef
varying clinical consequence- Undef
CBAVD 4612heterozygoteVUS3- Undef
CF-causing- Undef
CBAVD 4536heterozygoteCF-causing- Undef
CBAVD 4524heterozygoteCF-causing- Undef
likely CFTR-RD- Undef
CBAVD 6454heterozygoteCFTR-RD-causing- Undef
non-CF- Undef
CFTR-RD-causing- Undef
CBAVD 6455heterozygoteCF-causing- Undef
VUS3- Undef
CBAVD 6458heterozygoteVUS3- Undef
CF-causing- Undef
CBAVD 5314heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 5944heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 3388heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 6459heterozygoteCF-causing- Undef
VUS3- Undef
CBAVD 5330heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 5346heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 5590heterozygoteVUS3- Undef
CF-causing- Undef
CBAVD 5591heterozygoteCFTR-RD-causing- Undef
varying clinical consequence- Undef
CBAVD 5943heterozygoteVUS3- Undef
CF-causing- Undef
CBAVD 5946heterozygoteCF-causing- Undef
VUS3- Undef
CBAVD 5947heterozygoteVUS3- Undef
CF-causing- Undef
CBAVD 5768heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 5594heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 5764heterozygoteVUS3- Undef
CF-causing- Undef
CBAVD 5600heterozygoteVUS3- Undef
CBAVD 430heterozygoteVUS3- Undef
CF-causing- Undef
CBAVD 491heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 497heterozygoteVUS3- Undef
CF-causing- Undef
CBAVD 500heterozygotenon-CF- Undef
CF-causing- Undef
CBAVD 503heterozygoteCFTR-RD-causing- Undef
VUS3- Undef
CBAVD 505heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 511heterozygoteVUS3- Undef
VUS3- Undef
CBAVD 517heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 519heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 520heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 523heterozygotelikely CFTR-RD- Undef
varying clinical consequence- Undef
CBAVD 524heterozygoteCFTR-RD-causing- Undef
CBAVD 535heterozygoteCF-causing- Undef
VUS3- Undef
varying clinical consequence- Undef
CBAVD 537heterozygotevarying clinical consequence- Undef
CF-causing- Undef
CBAVD 490heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 434heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 448heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 452heterozygoteVUS3- Undef
CF-causing- Undef
CBAVD 453heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 455heterozygoteCFTR-RD-causing- Undef
CBAVD 456heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 461heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 462heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CFTR-RD-causing- Undef
CBAVD 467heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 475heterozygoteCFTR-RD-causing- Undef
non-CF- Undef
CF-causing- Undef
CBAVD 484heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 549heterozygoteVUS3- Undef
CF-causing- Undef
CBAVD 552heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 656heterozygotevarying clinical consequence- Undef
CF-causing- Undef
CBAVD 658heterozygoteVUS3- Undef
CF-causing- Undef
CBAVD 659heterozygoteVUS3- Undef
VUS3- Undef
CBAVD 664heterozygote
CBAVD 665heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 676heterozygoteCFTR-RD-causing- Undef
CBAVD 682heterozygoteVUS3- Undef
CF-causing- Undef
CBAVD 690heterozygote
CBAVD 710heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 735heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 653heterozygoteCFTR-RD-causing- Undef
varying clinical consequence- Undef
varying clinical consequence- Undef
CBAVD 556heterozygoteVUS3- Undef
CF-causing- Undef
CBAVD 614heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 615heterozygote
CBAVD 643heterozygoteCFTR-RD-causing- Undef
varying clinical consequence- Undef
CBAVD 743heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 4837heterozygoteCFTR-RD-causing- Undef
varying clinical consequence- Undef
CBAVD 4735heterozygoteVUS3- Undef
varying clinical consequence- Undef
CBAVD 4679heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 4683heterozygoteVUS3- Undef
CF-causing- Undef
CBAVD 4706heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 4710heterozygoteCFTR-RD-causing- Undef
VUS3- Undef
CF-causing- Undef
CBAVD 4729heterozygoteVUS3- Undef
likely CFTR-RD- Undef
CBAVD 5072heterozygoteCF-causing- Undef
VUS3- Undef
CBAVD 389heterozygoteCFTR-RD-causing- Undef
non-CF- Undef
CBAVD 416heterozygotevarying clinical consequence- Undef
CF-causing- Undef
CBAVD 422heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 423heterozygoteVUS3- Undef
CBAVD 1056heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 5181heterozygoteVUS3- Undef
CF-causing- Undef
VUS3- Undef
CBAVD 1048heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 5229heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 5228heterozygoteCFTR-RD-causing- Undef
VUS3- Undef
CBAVD 5235heterozygoteCF-causing- Undef
VUS3- Undef
CBAVD 5821heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 1287heterozygoteCFTR-RD-causing- Undef
varying clinical consequence- Undef
CBAVD 1163heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 1243heterozygotelikely CFTR-RD- Undef
VUS3- Undef
VUS2- Undef
CBAVD 1248heterozygoteVUS3- Undef
CF-causing- Undef
CBAVD 858heterozygote
CBAVD 868heterozygoteCF-causing- Undef
likely CFTR-RD- Undef
CBAVD 887heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 892heterozygotevarying clinical consequence- Undef
VUS3- Undef
CBAVD 900heterozygoteVUS3- Undef
CF-causing- Undef
CBAVD 912heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 927heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 938heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 857heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 856heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 840heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 763heterozygoteVUS3- Undef
CF-causing- Undef
CBAVD 765heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 781heterozygoteCFTR-RD-causing- Undef
CBAVD 805heterozygoteVUS1- Undef
CBAVD 812heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 818heterozygote
CBAVD 941heterozygoteVUS4- Undef
CF-causing- Undef
CBAVD 978heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 949heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 986heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 443homozygote
CBAVD 440homozygotec.1210-34_1210-6TG[11]T[5] - Trans
CBAVD 5129homozygotec.1519_1521del - p.(Ile507del) - Trans
c.1704G>T - p.(Leu568Phe) - Trans
CBAVD 720homozygotec.4097T>C - p.(Ile1366Thr) - Trans
CBAVD 725homozygotec.1210-34_1210-6TG[11]T[5] - Trans
c.1684G>A - p.(Val562Ile) - Trans
c.3846G>A - p.(Trp1282*) - Trans
CBAVD 504homozygotec.3964-3890_*3143delinsTAACT - p.? - Trans
c.509G>A - p.(Arg170His) - Trans
CBAVD 908homozygotec.1210-34_1210-6TG[11]T[5] - Trans
c.1466C>T - p.(Ser489Leu) - Trans
c.1684G>A - p.(Val562Ile) - Trans
CBAVD 5610homozygotec.1327G>T - p.(Asp443Tyr) - Trans
c.1521_1523del - p.(Phe508del) - Trans
CBAVD 919homozygotec.1210-34_1210-6TG[11]T[5] - Trans
c.1684G>A - p.(Val562Ile) - Trans
c.3846G>A - p.(Trp1282*) - Trans
CBAVD 5343homozygotec.2502T>G - p.(Phe834Leu) - Trans
c.3718-79T>C - p.(=) - Trans
CBAVD 396homozygote
CBAVD 881homozygotec.1210-34_1210-6TG[11]T[5] - Trans
c.617T>G - p.(Leu206Trp) - Trans
CBAVD 5592homozygotec.1210-34_1210-6TG[12]T[5] - Trans
c.233dup - p.(Trp79Leufs*32) - Trans
CBAVD 1132homozygotec.3208C>T - p.(Arg1070Trp) - Trans
c.509G>A - p.(Arg170His) - Trans
CBAVD 525homozygotec.1521_1523del - p.(Phe508del) - Trans
c.2991G>C - p.(Leu997Phe) - Trans
Pending (NBS) 3042heterozygoteCF-causing - Cis
varying clinical consequence - Trans
Pending (NBS) 2964heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Pending (NBS) 5017heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
Pending (NBS) 4643heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
Pending (NBS) 4631heterozygotevarying clinical consequence- Undef
CF-causing- Undef
Pending (NBS) 4654heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Pending (NBS) 2520heterozygoteCF-causing- Undef
Pending (NBS) 4407heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Pending (NBS) 4606heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Pending (NBS) 4508heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Pending (NBS) 4645heterozygoteCF-causing- Undef
VUS3- Undef
Pending (NBS) 6457heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Pending (NBS) 5769heterozygoteCF-causing- Undef
varying clinical consequence- Undef
VUS3- Undef
Pending (NBS) 5342heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Pending (NBS) 4694heterozygoteCF-causing- Undef
Pending (NBS) 387heterozygoteCF-causing- Undef
VUS3- Undef
Pending (NBS) 1070heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Pending (NBS) 5190heterozygoteCF-causing- Undef
VUS3- Undef
VUS3- Undef
varying clinical consequence- Undef
Pending (NBS) 1076heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Pending (NBS) 5202heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
VUS3- Undef
Pending (NBS) 5247heterozygoteCFTR-RD-causing- Undef
VUS3- Undef
CF-causing- Undef
VUS1- Undef
Pending (NBS) 4769heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Pending (NBS) 1547heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Pending (NBS) 1255heterozygotevarying clinical consequence- Undef
CF-causing- Undef
Pending (NBS) 1180heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Pending (NBS) 794heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Pending (NBS) 799heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Pending (NBS) 803heterozygoteVUS2- Undef
CF-causing- Undef
Pending (NBS) 991heterozygotevarying clinical consequence- Undef
Pending (NBS) 4644homozygotec.1209G>C - p.(Glu403Asp) - Trans
c.2657+5G>A - p.(=) - Trans
Pending (NBS) 5071homozygotec.-288G>C - p.(=) - Trans
c.2657+5G>A - p.(=) - Trans
c.3139+89T>C - p.(=) - Trans
Pending (NBS) 3676homozygotec.1652G>A - p.(Gly551Asp) - Trans
c.617T>G - p.(Leu206Trp) - Trans
Pending (NBS) 5609homozygotec.1070C>T - p.(Ala357Val) - Trans
c.2988+1G>A - p.(=) - Trans
Pancreatitis 3009heterozygoteCFTR-RD-causing - Cis
VUS1 - Trans
Pancreatitis 3016heterozygotevarying clinical consequence - Trans
Pancreatitis 3023heterozygoteCFTR-RD-causing- Undef
Pancreatitis 3044heterozygoteCFTR-RD-causing- Undef
Pancreatitis 3061heterozygoteCFTR-RD-causing- Undef
Pancreatitis 2919heterozygoteCFTR-RD-causing - Cis
CFTR-RD-causing - Trans
Pancreatitis 2978heterozygoteCFTR-RD-causing- Undef
Pancreatitis 3072heterozygoteCF-causing- Undef
Pancreatitis 3259heterozygotevarying clinical consequence- Undef
CF-causing- Undef
Pancreatitis 4619heterozygoteCFTR-RD-causing- Undef
VUS3- Undef
Pancreatitis 3221heterozygote
Pancreatitis 2377heterozygoteCF-causing- Undef
Pancreatitis 2408heterozygote
Pancreatitis 2414heterozygote
Pancreatitis 2417heterozygoteCFTR-RD-causing- Undef
varying clinical consequence- Undef
Pancreatitis 2418heterozygoteCFTR-RD-causing- Undef
Pancreatitis 2422heterozygote
Pancreatitis 2427heterozygoteCFTR-RD-causing- Undef
Pancreatitis 2372heterozygoteCFTR-RD-causing- Undef
Pancreatitis 2364heterozygote
Pancreatitis 2305heterozygoteVUS3- Undef
Pancreatitis 2306heterozygoteCFTR-RD-causing- Undef
Pancreatitis 2312heterozygoteCFTR-RD-causing- Undef
Pancreatitis 2318heterozygote
Pancreatitis 2319heterozygote
Pancreatitis 2321heterozygote
Pancreatitis 2322heterozygote
Pancreatitis 2324heterozygoteCFTR-RD-causing- Undef
Pancreatitis 2329heterozygoteVUS1- Undef
Pancreatitis 2338heterozygoteVUS3- Undef
Pancreatitis 2553heterozygoteCF-causing- Undef
Pancreatitis 2591heterozygoteCFTR-RD-causing- Undef
CFTR-RD-causing- Undef
Pancreatitis 2748heterozygoteCFTR-RD-causing- Undef
Pancreatitis 2528heterozygote
Pancreatitis 2451heterozygoteCFTR-RD-causing- Undef
Pancreatitis 2471heterozygoteVUS3- Undef
non-CF- Undef
Pancreatitis 2473heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Pancreatitis 2483heterozygoteCFTR-RD-causing- Undef
Pancreatitis 2486heterozygoteCFTR-RD-causing- Undef
non-CF- Undef
CFTR-RD-causing- Undef
Pancreatitis 2488heterozygoteCFTR-RD-causing- Undef
Pancreatitis 4659heterozygoteVUS3- Undef
Pancreatitis 4296heterozygote
Pancreatitis 4299heterozygotevarying clinical consequence- Undef
CF-causing- Undef
Pancreatitis 4301heterozygote
Pancreatitis 4240heterozygoteCF-causing- Undef
VUS3- Undef
Pancreatitis 4250heterozygoteCFTR-RD-causing- Undef
Pancreatitis 4256heterozygote
Pancreatitis 4270heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Pancreatitis 4581heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Pancreatitis 4614heterozygotevarying clinical consequence- Undef
varying clinical consequence- Undef
Pancreatitis 5977heterozygoteVUS3- Undef
Pancreatitis 5974heterozygoteVUS3- Undef
Pancreatitis 5010heterozygoteCFTR-RD-causing- Undef
CFTR-RD-causing- Undef
Pancreatitis 5336heterozygoteVUS3- Undef
VUS3- Undef
Pancreatitis 5340heterozygoteVUS3- Undef
Pancreatitis 5160heterozygoteCF-causing- Undef
varying clinical consequence- Undef
VUS3- Undef
Pancreatitis 5621heterozygote
Pancreatitis 5364heterozygoteVUS3- Undef
Pancreatitis 5605heterozygoteVUS2- Undef
Pancreatitis 5611heterozygoteCFTR-RD-causing- Undef
VUS3- Undef
Pancreatitis 5614heterozygoteVUS3- Undef
Pancreatitis 5617heterozygoteVUS3- Undef
Pancreatitis 5619heterozygoteVUS3- Undef
Pancreatitis 669heterozygoteCF-causing- Undef
Pancreatitis 648heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Pancreatitis 4708heterozygoteCFTR-RD-causing- Undef
VUS3- Undef
Pancreatitis 1524heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Pancreatitis 2285heterozygoteCFTR-RD-causing- Undef
Pancreatitis 1161heterozygoteCF-causing- Undef
VUS3- Undef
Pancreatitis 1063heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Bronchiectasis 4725heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
Bronchiectasis 4726heterozygoteCFTR-RD-causing- Undef
varying clinical consequence- Undef
Bronchiectasis 693heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
VUS1- Undef
Bronchiectasis 1096heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Bronchiectasis 4870heterozygoteCFTR-RD-causing- Undef
CFTR-RD-causing- Undef
CFTR-RD-causing- Undef
Bronchiectasis 2287heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Bronchiectasis 2289heterozygoteCFTR-RD-causing- Undef
Bronchiectasis 2291heterozygoteCFTR-RD-causing- Undef
Bronchiectasis 2367heterozygoteCFTR-RD-causing- Undef
Bronchiectasis 2409heterozygoteCF-causing- Undef
VUS3- Undef
Bronchiectasis 2419heterozygoteCFTR-RD-causing- Undef
non-CF- Undef
Bronchiectasis 2420heterozygoteCF-causing- Undef
Bronchiectasis 2424heterozygote
Bronchiectasis 2446heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Bronchiectasis 2533heterozygoteCFTR-RD-causing- Undef
Bronchiectasis 2960heterozygoteCFTR-RD-causing - Trans
Bronchiectasis 2988heterozygoteCFTR-RD-causing- Undef
varying clinical consequence- Undef
CF-causing- Undef
Bronchiectasis 3038heterozygoteCFTR-RD-causing - Cis
Bronchiectasis 3085heterozygotenon-CF- Undef
Bronchiectasis 4657heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Bronchiectasis 5972heterozygoteCFTR-RD-causing- Undef
varying clinical consequence- Undef
Bronchiectasis 6435heterozygoteCFTR-RD-causing- Undef
varying clinical consequence- Undef
Bronchiectasis 5624heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Bronchiectasis 5589heterozygoteVUS3 - Cis
CFTR-RD-causing - Trans
Bronchiectasis 4242heterozygoteCF-causing- Undef
Bronchiectasis 4253heterozygote
Bronchiectasis 4308heterozygote
Bronchiectasis 4474heterozygotevarying clinical consequence- Undef
Bronchiectasis 4602heterozygoteCFTR-RD-causing- Undef
varying clinical consequence- Undef
Bronchiectasis 5074homozygotec.1210-34_1210-6TG[11]T[5] - Trans
Bronchiectasis 5076homozygotec.2658-77T>A - p.(=) - Trans
Bronchiectasis 777homozygotec.1210-34_1210-6TG[11]T[5] - Trans
c.1684G>A - p.(Val562Ile) - Trans
Bronchiectasis 966homozygotec.1585-9418T>C - p.(=) - Trans
c.899C>A - p.(Ala300Asp) - Trans
Bronchiectasis 5126homozygotec.1327G>T - p.(Asp443Tyr) - Trans
Asymptomatic compound heterozygote 5073heterozygote
Asymptomatic compound heterozygote 5081heterozygote
Asymptomatic compound heterozygote 5077heterozygoteVUS3- Undef
Asymptomatic compound heterozygote 558heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
Asymptomatic compound heterozygote 5220heterozygoteCFTR-RD-causing- Undef
non-CF- Undef
Asymptomatic compound heterozygote 5141heterozygoteVUS3- Undef
Asymptomatic compound heterozygote 5140heterozygoteVUS3- Undef
CF-causing- Undef
Asymptomatic compound heterozygote 5133heterozygoteVUS3- Undef
Asymptomatic compound heterozygote 1083heterozygoteCF-causing- Undef
Asymptomatic compound heterozygote 1290heterozygoteCFTR-RD-causing- Undef
Asymptomatic compound heterozygote 2863heterozygoteCF-causing- Undef
Asymptomatic compound heterozygote 3235heterozygoteCFTR-RD-causing- Undef
CFTR-RD-causing- Undef
Asymptomatic compound heterozygote 4628heterozygoteVUS3- Undef
CFTR-RD-causing- Undef
Asymptomatic compound heterozygote 4617heterozygoteVUS3 - Cis
CF-causing - Trans
Asymptomatic compound heterozygote 4763heterozygoteCF-causing- Undef
Asymptomatic compound heterozygote 6434heterozygoteCFTR-RD-causing- Undef
VUS3- Undef
Asymptomatic compound heterozygote 6437heterozygoteCFTR-RD-causing- Undef
VUS3- Undef
Asymptomatic compound heterozygote 5601heterozygoteCF-causing- Undef
Asymptomatic compound heterozygote 5602heterozygoteVUS3- Undef
VUS3- Undef
Asymptomatic compound heterozygote 5606heterozygoteCFTR-RD-causing- Undef
non-CF- Undef
CF-causing- Undef
Asymptomatic compound heterozygote 5964heterozygoteVUS3- Undef
CF-causing- Undef
Asymptomatic compound heterozygote 4260heterozygoteVUS3- Undef
CFTR-RD-causing- Undef
Asymptomatic compound heterozygote 4285heterozygoteCFTR-RD-causing - Cis
VUS2 - Trans
Asymptomatic compound heterozygote 4303heterozygoteCFTR-RD-causing- Undef
Asymptomatic compound heterozygote 4522heterozygoteCF-causing- Undef
VUS1- Undef
Asymptomatic compound heterozygote 4523heterozygotevarying clinical consequence- Undef
Asymptomatic compound heterozygote 4526heterozygoteVUS1- Undef
Asymptomatic compound heterozygote 5745homozygotec.1210-34_1210-6TG[11]T[5] - Trans
c.3256A>G - p.(Thr1086Ala) - Trans
Asymptomatic compound heterozygote 4741homozygotec.489+3A>G - p.(=) - Trans
Asymptomatic compound heterozygote 5362homozygotec.1696G>A - p.(Ala566Thr) - Trans
c.2743G>C - p.(Val915Leu) - Trans
Pending 243heterozygote
Pending 312heterozygoteCFTR-RD-causing- Undef
Pending 1097heterozygotevarying clinical consequence - Cis
VUS3 - Trans
Pending 3073heterozygoteCF-causing- Undef
VUS3- Undef
Pending 3165heterozygoteCFTR-RD-causing- Undef
varying clinical consequence- Undef
Pending 5008heterozygotevarying clinical consequence- Undef
CF-causing- Undef
Pending non-CF 4825heterozygoteVUS3- Undef
varying clinical consequence- Undef
Pending non-CF 3094heterozygoteCFTR-RD-causing- Undef
varying clinical consequence- Undef
Pending non-CF 5009heterozygoteVUS3- Undef
CF-causing- Undef
Pending non-CF 4515heterozygotevarying clinical consequence- Undef
varying clinical consequence- Undef
CRS-NP 5138heterozygoteVUS3- Undef
CRS-NP 5531heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
VUS3- Undef
CRS-NP 3078heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CRS-NP 3126heterozygoteCFTR-RD-causing- Undef
CFTR-RD-causing- Undef
CRS-NP 3161heterozygoteCF-causing- Undef
VUS1- Undef
varying clinical consequence- Undef
CRS-NP 4276heterozygoteCFTR-RD-causing- Undef
CRS-NP 4805heterozygote
Aquagenic palmoplantar keratoderma 5822heterozygoteCFTR-RD-causing- Undef
non-CF- Undef
Aquagenic palmoplantar keratoderma 5613heterozygotenon-CF- Undef
Aquagenic palmoplantar keratoderma 4660homozygotec.2657+5G>A - p.(=) - Trans
Aquagenic palmoplantar keratoderma 5772homozygotec.4139C>T - p.(Thr1380Ile) - Trans


Color code:   non disease-causing <   likely benign <   VUS <   likely pathogenic <   disease-causing



            CFTR variants are clustered into five groups:
  • CF-causing: when in trans with another CF-causing mutation, will result in CF.
  • CFTR-RD causing: when in trans with a CF-causing mutation, will result in CFTR-related disorders (CFTR-RD) such as chronic pancreatitis, bronchiectasis, CRS-NP (chronic rhinosinusitis with or without nasal polyposis) or CBAVD (congenital absence of vas deferens), according to Bombieri C et al., 2011.
  • Varying clinical consequence: when in trans with another CF-causing mutation, can either result in CF or in a CFTR-RD.
  • Non disease-causing: when in trans with a CF-causing mutation, will not cause CF, nor CFTR-RD.
  • VUS (Variant of unknown clinical significance): unclassified because of insufficient data.



Go to CFTRare