Variant NM_000492.4:c.2562T>G


Variant details:
Name NM_000492.4:c.2562T>G
Protein name NP_000483.3:p.(=)
Genomic name (hg19)     chr7:g.117235055T>G    UCSC    
Genomic name (hg38) chr7:g.117595001T>G    UCSC
#Exon/intron exon 15
Legacy Name T854T (2694T/G)
Class non disease-causing
WT sequence GGAACACATACCTTCGATATATTAC T GTCCACAAGAGCTTAATTTTTGTGC
Mutant sequence GGAACACATACCTTCGATATATTAC G GTCCACAAGAGCTTAATTTTTGTGC

Other databases:
dbSNP
rs1042077







Pathogenicity predictors:

Not found




66 individuals carrying this variant are reported in CFTR-NGS catalogue


800 patients carrying this variant are reported in CFTR-France:

TOTAL NUMBER OF PATIENTS 800
Asymptomatic compound heterozygote 34
CF 244
CFTR-RD457
  • Aquagenic palmoplantar keratoderma  5
  • Bronchiectasis  55
  • CBAVD  233
  • CRS-NP  9
  • Other  65
  • Pancreatitis  90
Fetal bowel anomalies 4
Pending 10
Pending (NBS) 48
Pending non-CF 3




Color code:   non disease-causing <   likely benign <   VUS <   likely pathogenic <   disease-causing

Detailed genotypes:
Phenotype Patient ID Variant status Additional variants
CF 3000heterozygoteCF-causing- Undef
CF-causing- Undef
CF 2999heterozygoteCF-causing- Undef
CF-causing- Undef
CF 2994heterozygotevarying clinical consequence- Undef
CF-causing- Undef
CF 2962heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 2950heterozygoteCF-causing- Undef
CF-causing- Undef
CF 3005heterozygoteCF-causing - Cis
CF-causing - Trans
CF 3045heterozygoteCF-causing - Cis
CF-causing - Trans
CF 3037heterozygoteCF-causing- Undef
CF-causing- Undef
CF 4633heterozygoteCF-causing- Undef
CF-causing- Undef
CF 3026heterozygoteCF-causing - Cis
VUS3 - Trans
CF-causing - Trans
CF 3021heterozygoteCF-causing - Cis
varying clinical consequence - Trans
CF 2947heterozygoteCF-causing- Undef
CF-causing- Undef
CF 2932heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 2836heterozygoteCF-causing - Cis
CF-causing - Trans
CF 5067heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 2828heterozygoteCF-causing- Undef
CF-causing- Undef
CF 2821heterozygotevarying clinical consequence - Cis
CF-causing - Trans
CF 2882heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 2888heterozygoteCF-causing- Undef
CF-causing- Undef
CF 2898heterozygoteCF-causing- Undef
CF-causing- Undef
VUS3- Undef
CF 2802heterozygoteCF-causing- Undef
CF-causing- Undef
CF 4759heterozygoteCF-causing- Undef
CF-causing- Undef
CF 3255heterozygoteCF-causing- Undef
CF-causing- Undef
CF 3217heterozygoteCF-causing- Undef
CF-causing- Undef
CF 4629heterozygoteCF-causing- Undef
CF-causing- Undef
VUS3- Undef
CF 3200heterozygoteCF-causing- Undef
CF-causing- Undef
CF 3066heterozygoteCF-causing- Undef
CF-causing- Undef
CF 3097heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 3119heterozygoteCF-causing- Undef
CF-causing- Undef
CF 3150heterozygoteCF-causing- Undef
CF-causing- Undef
CF 3145heterozygoteCF-causing- Undef
CF-causing- Undef
CF 3144heterozygoteCF-causing- Undef
CF-causing- Undef
CF 3140heterozygoteCF-causing- Undef
CF-causing- Undef
VUS3- Undef
CF 2333heterozygoteCF-causing- Undef
CF-causing- Undef
CF 1757heterozygoteCF-causing- Undef
VUS3- Undef
CF 1584heterozygoteCF-causing- Undef
CF-causing- Undef
CF 1440heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 4858heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 1320heterozygoteCF-causing- Undef
CF-causing- Undef
CF 1317heterozygotevarying clinical consequence- Undef
CF-causing- Undef
CF 1313heterozygotelikely CF- Undef
CF 1516heterozygoteCF-causing- Undef
VUS2- Undef
CF 1528heterozygote
CF 1536heterozygoteCF-causing- Undef
CF-causing- Undef
CF 1581heterozygoteCF-causing- Undef
CF-causing- Undef
CF 1569heterozygote
CF 1562heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CF 1561heterozygoteCF-causing- Undef
CF-causing- Undef
CF 1559heterozygoteCF-causing- Undef
CF-causing- Undef
CF 1557heterozygoteCF-causing- Undef
CF-causing- Undef
CF 1538heterozygoteCF-causing- Undef
CF-causing- Undef
CF 1295heterozygotelikely CF - Cis
likely CF - Trans
CF 2760heterozygotevarying clinical consequence- Undef
CF-causing- Undef
CF 2515heterozygoteCF-causing- Undef
CF-causing- Undef
CF 2489heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 2568heterozygoteCF-causing- Undef
CF-causing- Undef
CF 2546heterozygoteCF-causing- Undef
CF 2459heterozygoteCF-causing- Undef
CF-causing- Undef
CF 2361heterozygoteCF-causing- Undef
CF-causing- Undef
CF 4112heterozygoteCF-causing- Undef
CF-causing- Undef
CF 4087heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 4043heterozygoteCF-causing- Undef
CF-causing- Undef
CF 3917heterozygotevarying clinical consequence - Cis
CF-causing - Trans
CF 3674heterozygoteCF-causing- Undef
CF-causing- Undef
CF 3666heterozygoteCF-causing- Undef
CF-causing- Undef
CF 4225heterozygoteCF-causing- Undef
CF-causing- Undef
CF 4237heterozygoteCF-causing- Undef
CF-causing- Undef
CF 4538heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CF-causing- Undef
CF 4535heterozygoteCF-causing- Undef
CF-causing- Undef
CF 4390heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 4386heterozygotelikely CFTR-RD- Undef
CF 4380heterozygoteCF-causing- Undef
CF-causing- Undef
CF 4376heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 4363heterozygoteCF-causing- Undef
CF 4360heterozygoteCF-causing- Undef
CF-causing- Undef
CF 4357heterozygoteCF-causing- Undef
CF-causing- Undef
CF 4351heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 4439heterozygoteCF-causing- Undef
CF-causing- Undef
CF 4502heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 4499heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 4483heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 4480heterozygoteCF-causing- Undef
VUS2- Undef
CF 4347heterozygoteCF-causing- Undef
CF-causing- Undef
CF 5971heterozygoteCF-causing- Undef
VUS3- Undef
CF 6432heterozygoteVUS3- Undef
CF-causing- Undef
CF 6456heterozygoteCF-causing- Undef
varying clinical consequence- Undef
VUS3- Undef
CF 6453heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 6441heterozygoteCF-causing- Undef
CF-causing- Undef
CF 4747heterozygoteCF-causing- Undef
CF-causing- Undef
CF 4744heterozygoteCF-causing- Undef
VUS3- Undef
CF 4765heterozygoteVUS3- Undef
varying clinical consequence- Undef
CF-causing- Undef
CF 5345heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 5174heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 5622heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 5770heterozygoteVUS3- Undef
CF-causing- Undef
CF 5948heterozygoteCF-causing- Undef
CF-causing- Undef
CF 5777heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CF-causing- Undef
CF 5965heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 5328heterozygoteCF-causing- Undef
CF-causing- Undef
CF 488heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 471heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 661heterozygoteCF-causing - Cis
CF-causing - Trans
CF 631heterozygoteCF-causing - Cis
CF-causing - Trans
CF 617heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 601heterozygoteCF-causing- Undef
CF-causing- Undef
CF 594heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 174heterozygoteCF-causing- Undef
CF-causing- Undef
CF 637heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 654heterozygoteCF-causing- Undef
CF-causing- Undef
CF 652heterozygoteCF-causing- Undef
CF-causing- Undef
CF 642heterozygoteCF-causing - Cis
CF-causing - Trans
CF 586heterozygoteCF-causing- Undef
CF-causing- Undef
CF 582heterozygotevarying clinical consequence- Undef
CF-causing- Undef
CF 579heterozygotevarying clinical consequence- Undef
CF-causing- Undef
CF 570heterozygotevarying clinical consequence- Undef
CF-causing- Undef
CF 559heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 200heterozygoteCF-causing- Undef
CF-causing- Undef
CF 140heterozygoteCF-causing - Cis
CF-causing - Trans
CF 138heterozygoteCF-causing - Cis
CF-causing - Trans
CF 126heterozygotevarying clinical consequence - Cis
CF-causing - Trans
CF 111heterozygotevarying clinical consequence- Undef
CF-causing- Undef
CF 103heterozygoteCF-causing - Cis
CF-causing - Trans
CF 102heterozygoteCF-causing - Cis
CF-causing - Trans
CF 94heterozygoteCF-causing - Cis
CF-causing - Trans
CF 90heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 143heterozygoteCF-causing- Undef
CF-causing- Undef
CF 145heterozygoteCF-causing - Cis
CF-causing - Trans
CF 197heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 177heterozygoteCF-causing- Undef
CF-causing- Undef
CF 176heterozygoteCF-causing- Undef
CF-causing- Undef
CF 175heterozygoteCF-causing- Undef
CF-causing- Undef
CF 169heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 159heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 158heterozygoteCF-causing- Undef
CF-causing- Undef
CF 147heterozygoteCF-causing- Undef
CF-causing- Undef
CF 146heterozygoteCF-causing- Undef
CF-causing- Undef
CF 86heterozygoteCF-causing- Undef
CF-causing- Undef
CF 4665heterozygoteVUS3- Undef
CF 4697heterozygoteCF-causing- Undef
CF-causing- Undef
CF 207heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 373heterozygoteCF-causing- Undef
CF-causing- Undef
CF 369heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 361heterozygoteCF-causing- Undef
CF-causing- Undef
CF 359heterozygoteCF-causing- Undef
CF-causing- Undef
VUS3- Undef
CF 351heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 350heterozygoteCF-causing- Undef
CF-causing- Undef
CF 348heterozygoteCF-causing - Cis
CF-causing - Trans
CF 341heterozygoteCF-causing- Undef
CF-causing- Undef
CF 379heterozygoteCF-causing- Undef
CF-causing- Undef
CF 383heterozygotevarying clinical consequence- Undef
CF-causing- Undef
CF-causing- Undef
CF 3476heterozygoteCF-causing- Undef
CF-causing- Undef
CF 384heterozygoteCF-causing- Undef
CF-causing- Undef
CF 335heterozygoteCF-causing- Undef
CF-causing- Undef
CF 330heterozygoteCF-causing - Cis
CF-causing - Trans
CF 326heterozygotevarying clinical consequence- Undef
CF-causing- Undef
CF 247heterozygoteVUS3- Undef
CF-causing- Undef
CF 236heterozygoteCF-causing- Undef
CF-causing- Undef
CF 232heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 230heterozygoteCF-causing- Undef
CF-causing- Undef
CF 227heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 252heterozygoteCF-causing- Undef
CF-causing- Undef
CF 280heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 322heterozygoteCF-causing- Undef
CF-causing- Undef
CF 320heterozygoteCF-causing- Undef
CF-causing- Undef
CF 308heterozygoteCF-causing- Undef
CF-causing- Undef
CF 305heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CF 303heterozygoteCF-causing- Undef
CF-causing- Undef
CF 294heterozygoteVUS1- Undef
CF 289heterozygoteCF-causing- Undef
likely CF- Undef
CF 284heterozygotevarying clinical consequence- Undef
CF-causing- Undef
CF 219heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 4785heterozygotevarying clinical consequence- Undef
CF-causing- Undef
CF 5244heterozygoteCF-causing- Undef
VUS3- Undef
CF 4782heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 4780heterozygoteCF-causing- Undef
CF-causing- Undef
CF 1027heterozygoteCF-causing- Undef
CF-causing- Undef
CF 5807heterozygoteCF-causing- Undef
CF-causing- Undef
CF 975heterozygoteCF-causing- Undef
CF 947heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 945heterozygoteCF-causing- Undef
CF-causing- Undef
CF 943heterozygotevarying clinical consequence- Undef
CF-causing- Undef
CF 1005heterozygoteCF-causing - Cis
CF-causing - Trans
CF 5215heterozygoteCFTR-RD-causing- Undef
VUS3- Undef
CF 1011heterozygoteCF-causing - Cis
CF-causing - Trans
CF 1006heterozygoteCF-causing - Cis
CF-causing - Trans
CF 1186heterozygoteCF-causing- Undef
CF-causing- Undef
CF 1178heterozygoteCF-causing- Undef
CF-causing- Undef
CF 1170heterozygoteCF-causing- Undef
CF-causing- Undef
CF 1226heterozygoteCF-causing- Undef
CF-causing- Undef
CF 1228heterozygoteCF-causing- Undef
CF-causing- Undef
CF 1289heterozygoteCF-causing- Undef
CF-causing- Undef
CF 1285heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
non-CF- Undef
CF-causing- Undef
CF 1271heterozygoteCF-causing - Cis
varying clinical consequence - Cis
CF-causing - Trans
varying clinical consequence - Trans
CF 1232heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 1231heterozygoteCF-causing- Undef
CF-causing- Undef
CF 1139heterozygoteCF-causing- Undef
CF-causing- Undef
CF 1138heterozygoteCF-causing- Undef
CF-causing- Undef
CF 4796heterozygoteVUS3- Undef
CF-causing- Undef
VUS3- Undef
varying clinical consequence- Undef
CF 1137heterozygoteCF-causing - Cis
CF-causing - Trans
CF 1128heterozygotevarying clinical consequence- Undef
CF-causing- Undef
CF 822heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 829heterozygoteCF-causing- Undef
varying clinical consequence- Undef
VUS3- Undef
CF 716heterozygoteCF-causing- Undef
CF-causing- Undef
CF 835heterozygoteCF-causing- Undef
CF-causing- Undef
CF 863heterozygoteCF-causing- Undef
CF-causing- Undef
CF 691heterozygoteCF-causing- Undef
CF-causing- Undef
CF 686heterozygoteVUS3- Undef
CF 808heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 816heterozygoteCF-causing- Undef
CF-causing- Undef
CF 909heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 920heterozygoteVUS2- Undef
CF-causing- Undef
CF-causing- Undef
CF 663heterozygoteVUS2- Undef
CF-causing- Undef
varying clinical consequence- Undef
CF 662heterozygoteVUS2- Undef
CF-causing- Undef
varying clinical consequence- Undef
CF 882heterozygoteCF-causing- Undef
CF-causing- Undef
CF 4541homozygotec.2215del - p.(Val739Tyrfs*16) - Trans
c.3160C>G - p.(His1054Asp) - Trans
CF 156homozygotec.2657+5G>A - p.(=) - Trans
c.2997_3000del - p.(Ile1000*) - Trans
CF 153homozygotec.1519_1521del - p.(Ile507del) - Trans
c.861_865del - p.(Asn287Lysfs*19) - Trans
CF 5188homozygotec.1792A>T - p.(Lys598*) - Trans
CF 28homozygotec.3846G>A - p.(Trp1282*) - Trans
CF 5016homozygotec.3909C>G - p.(Asn1303Lys) - Trans
c.870-1113_870-1110del - p.(=) - Trans
CF 136homozygotec.3846G>A - p.(Trp1282*) - Trans
CF 129homozygotec.3883_3886del - p.(Ile1295Phefs*32) - Trans
CF 26homozygotec.3846G>A - p.(Trp1282*) - Trans
CF 3223homozygotec.1657C>T - p.(Arg553*) - Trans
c.617T>G - p.(Leu206Trp) - Trans
CF 101homozygotec.2988+1G>A - p.(=) - Trans
CF 1527homozygotec.1210-34_1210-6TG[12]T[5] - Trans
c.1521_1523del - p.(Phe508del) - Trans
CF 4718homozygotec.2374C>T - p.(Arg792*) - Trans
c.870-1113_870-1110del - p.(=) - Trans
CF 1260homozygotec.1210-34_1210-6TG[10]T[8] - Trans
c.4137-89A>G - p.(=) - Trans
c.4242+1G>A - p.(=) - Trans
CF 4553homozygotec.254G>T - p.(Gly85Val) - Trans
c.274-2A>G - p.(=) - Trans
CF 112homozygotec.3883_3886del - p.(Ile1295Phefs*32) - Trans
CF 4688homozygotec.1519_1521del - p.(Ile507del) - Trans
c.2657+5G>A - p.(=) - Trans
CF 3228homozygotec.1657C>T - p.(Arg553*) - Trans
c.3718-2477C>T - p.(=) - Trans
CF 5069homozygotec.1393-1G>A - p.(=) - Trans
c.1680-981T>C - p.(=) - Trans
c.3874-4522A>G - p.(=) - Trans
CF 2974homozygotec.1585-1G>A - p.(=) - Trans
c.2875del - p.(Ala959Hisfs*9) - Trans
CF 2975homozygotec.1585-1G>A - p.(=) - Trans
c.2875del - p.(Ala959Hisfs*9) - Trans
CF 5341homozygotec.296C>G - p.(Pro99Arg) - Trans
c.3846G>A - p.(Trp1282*) - Trans
CF 1293homozygotec.1801A>T - p.(Ile601Phe) - Trans
c.3846G>A - p.(Trp1282*) - Trans
CF 977homozygotec.680T>G - p.(Leu227Arg) - Trans
CF 211homozygotec.3623del - p.(Gly1208Alafs*3) - Trans
CF 730homozygotec.3131A>G - p.(Glu1044Gly) - Trans
CF 381homozygotec.1519_1521del - p.(Ile507del) - Trans
c.617T>G - p.(Leu206Trp) - Trans
CF 327homozygotec.1585-1G>A - p.(=) - Trans
c.2988+1G>A - p.(=) - Trans
CF 324homozygotec.580-1G>T - p.(=) - Trans
CF 316homozygotec.1657C>T - p.(Arg553*) - Trans
c.870-1113_870-1110del - p.(=) - Trans
CBAVD 5068heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 5022heterozygoteCFTR-RD-causing- Undef
CFTR-RD-causing- Undef
VUS3- Undef
varying clinical consequence- Undef
CBAVD 2853heterozygoteVUS3- Undef
CF-causing- Undef
CBAVD 5018heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 4653heterozygoteCFTR-RD-causing- Undef
varying clinical consequence- Undef
CBAVD 4752heterozygoteVUS3- Undef
CF-causing- Undef
CBAVD 4761heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 4756heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 4663heterozygotevarying clinical consequence- Undef
CF-causing- Undef
CBAVD 4651heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
VUS3- Undef
CBAVD 3267heterozygoteVUS3- Undef
CF-causing- Undef
CBAVD 3288heterozygoteCF-causing- Undef
VUS3- Undef
CBAVD 3064heterozygoteCFTR-RD-causing - Cis
CF-causing - Trans
CBAVD 3125heterozygoteCF-causing- Undef
VUS3- Undef
varying clinical consequence- Undef
CBAVD 2336heterozygoteCFTR-RD-causing- Undef
CFTR-RD-causing- Undef
CBAVD 2525heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 2504heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
VUS3- Undef
CBAVD 2485heterozygoteVUS3- Undef
CF-causing- Undef
VUS3- Undef
CBAVD 2549heterozygoteCF-causing- Undef
CBAVD 2400heterozygote
CBAVD 2390heterozygoteCF-causing- Undef
CBAVD 2421heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 4331heterozygoteVUS3- Undef
CF-causing- Undef
CBAVD 4279heterozygoteVUS3- Undef
CF-causing- Undef
CBAVD 4271heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 4814heterozygoteCF-causing- Undef
CBAVD 4311heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 4309heterozygoteCF-causing- Undef
VUS3- Undef
CBAVD 4238heterozygoteCF-causing- Undef
likely CFTR-RD- Undef
CBAVD 4239heterozygoteCF-causing- Undef
likely CFTR-RD- Undef
CBAVD 4333heterozygotevarying clinical consequence- Undef
non-CF- Undef
CBAVD 4554heterozygoteVUS4- Undef
CBAVD 4552heterozygoteCF-causing- Undef
CBAVD 4536heterozygoteCF-causing- Undef
CBAVD 4534heterozygoteVUS3- Undef
CF-causing- Undef
CBAVD 4571heterozygoteVUS3- Undef
CF-causing- Undef
CBAVD 4574heterozygoteVUS3- Undef
CF-causing- Undef
CBAVD 4612heterozygoteVUS3- Undef
CF-causing- Undef
CBAVD 4599heterozygoteCFTR-RD-causing - Cis
CFTR-RD-causing - Trans
varying clinical consequence- Undef
CBAVD 4592heterozygoteCFTR-RD-causing- Undef
varying clinical consequence- Undef
CBAVD 4577heterozygoteCFTR-RD-causing- Undef
varying clinical consequence- Undef
CBAVD 4531heterozygoteCF-causing- Undef
CBAVD 4529heterozygoteCF-causing- Undef
VUS2- Undef
VUS3- Undef
CBAVD 4419heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 4524heterozygoteCF-causing- Undef
likely CFTR-RD- Undef
CBAVD 5944heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 5591heterozygoteCFTR-RD-causing- Undef
varying clinical consequence- Undef
CBAVD 6458heterozygoteVUS3- Undef
CF-causing- Undef
CBAVD 6455heterozygoteCF-causing- Undef
VUS3- Undef
CBAVD 6454heterozygoteCFTR-RD-causing- Undef
non-CF- Undef
CFTR-RD-causing- Undef
CBAVD 5590heterozygoteVUS3- Undef
CF-causing- Undef
CBAVD 5346heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 3326heterozygoteCFTR-RD-causing- Undef
CBAVD 4750heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 3388heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 5343heterozygoteVUS3- Undef
VUS3- Undef
CBAVD 5173heterozygoteCF-causing- Undef
varying clinical consequence- Undef
VUS3- Undef
CBAVD 6459heterozygoteCF-causing- Undef
VUS3- Undef
CBAVD 5768heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 5947heterozygoteVUS3- Undef
CF-causing- Undef
CBAVD 5946heterozygoteCF-causing- Undef
VUS3- Undef
CBAVD 5943heterozygoteVUS3- Undef
CF-causing- Undef
CBAVD 5765heterozygotevarying clinical consequence- Undef
CF-causing- Undef
CBAVD 5594heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 5610heterozygoteVUS3- Undef
CF-causing- Undef
CBAVD 5764heterozygoteVUS3- Undef
CF-causing- Undef
CBAVD 5600heterozygoteVUS3- Undef
CBAVD 5603heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 512heterozygoteCFTR-RD-causing- Undef
CFTR-RD-causing- Undef
CBAVD 484heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 480heterozygoteVUS3- Undef
CF-causing- Undef
CBAVD 479heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 478heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 475heterozygoteCFTR-RD-causing- Undef
non-CF- Undef
CF-causing- Undef
CBAVD 474heterozygotevarying clinical consequence- Undef
CF-causing- Undef
CBAVD 470heterozygotevarying clinical consequence- Undef
CF-causing- Undef
CBAVD 490heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 491heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 511heterozygoteVUS3- Undef
VUS3- Undef
CBAVD 510heterozygoteCFTR-RD-causing- Undef
CBAVD 506heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 505heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 504heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 503heterozygoteCFTR-RD-causing- Undef
VUS3- Undef
CBAVD 500heterozygotenon-CF- Undef
CF-causing- Undef
CBAVD 497heterozygoteVUS3- Undef
CF-causing- Undef
CBAVD 493heterozygotevarying clinical consequence- Undef
CF-causing- Undef
CBAVD 468heterozygoteCF-causing- Undef
CBAVD 467heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 430heterozygoteVUS3- Undef
CF-causing- Undef
CBAVD 427heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 426heterozygotevarying clinical consequence- Undef
CF-causing- Undef
CBAVD 424heterozygoteVUS3- Undef
CF-causing- Undef
CBAVD 423heterozygoteVUS3- Undef
CBAVD 422heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 420heterozygoteCF-causing- Undef
non-CF- Undef
CBAVD 419heterozygoteVUS3- Undef
CF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 416heterozygotevarying clinical consequence- Undef
CF-causing- Undef
CBAVD 431heterozygote
CBAVD 433heterozygoteVUS3- Undef
CF-causing- Undef
CBAVD 462heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CFTR-RD-causing- Undef
CBAVD 461heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 456heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 455heterozygoteCFTR-RD-causing- Undef
CBAVD 453heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 452heterozygoteVUS3- Undef
CF-causing- Undef
CBAVD 448heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 438heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 436heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 409heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 517heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 626heterozygoteCFTR-RD-causing- Undef
varying clinical consequence- Undef
CBAVD 615heterozygote
CBAVD 614heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 640heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 659heterozygoteVUS3- Undef
VUS3- Undef
CBAVD 658heterozygoteVUS3- Undef
CF-causing- Undef
CBAVD 653heterozygoteCFTR-RD-causing- Undef
varying clinical consequence- Undef
varying clinical consequence- Undef
CBAVD 643heterozygoteCFTR-RD-causing- Undef
varying clinical consequence- Undef
CBAVD 583heterozygoteCFTR-RD-causing- Undef
VUS3- Undef
CBAVD 534heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 533heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 530heterozygotevarying clinical consequence- Undef
CF-causing- Undef
CBAVD 529heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
VUS3- Undef
CBAVD 527heterozygotevarying clinical consequence- Undef
CBAVD 526heterozygoteVUS3- Undef
CBAVD 524heterozygoteCFTR-RD-causing- Undef
CBAVD 523heterozygotelikely CFTR-RD- Undef
varying clinical consequence- Undef
CBAVD 522heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 535heterozygoteCF-causing- Undef
VUS3- Undef
varying clinical consequence- Undef
CBAVD 549heterozygoteVUS3- Undef
CF-causing- Undef
CBAVD 572heterozygoteCF-causing- Undef
likely CFTR-RD- Undef
CBAVD 556heterozygoteVUS3- Undef
CF-causing- Undef
CBAVD 555heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 553heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 552heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 519heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 4837heterozygoteCFTR-RD-causing- Undef
varying clinical consequence- Undef
CBAVD 4683heterozygoteVUS3- Undef
CF-causing- Undef
CBAVD 4679heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 81heterozygotevarying clinical consequence- Undef
CF-causing- Undef
CBAVD 65heterozygotevarying clinical consequence- Undef
CF-causing- Undef
CBAVD 4735heterozygoteVUS3- Undef
varying clinical consequence- Undef
CBAVD 4729heterozygoteVUS3- Undef
likely CFTR-RD- Undef
CBAVD 4710heterozygoteCFTR-RD-causing- Undef
VUS3- Undef
CF-causing- Undef
CBAVD 4707heterozygotevarying clinical consequence- Undef
CF-causing- Undef
CBAVD 4706heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 650heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 404heterozygotevarying clinical consequence- Undef
VUS3- Undef
CBAVD 403heterozygoteVUS3- Undef
CFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 401heterozygoteCF-causing- Undef
CBAVD 400heterozygotevarying clinical consequence- Undef
CF-causing- Undef
non-CF- Undef
CBAVD 397heterozygotevarying clinical consequence- Undef
CF-causing- Undef
CBAVD 396heterozygote
CBAVD 394heterozygotevarying clinical consequence- Undef
CF-causing- Undef
CBAVD 389heterozygoteCFTR-RD-causing- Undef
non-CF- Undef
CBAVD 5228heterozygoteCFTR-RD-causing- Undef
VUS3- Undef
CBAVD 5229heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 5821heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 1030heterozygotevarying clinical consequence- Undef
CFTR-RD-causing- Undef
CBAVD 1025heterozygoteVUS3- Undef
CBAVD 986heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 978heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 949heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 941heterozygoteVUS4- Undef
CF-causing- Undef
CBAVD 1177heterozygotevarying clinical consequence- Undef
CBAVD 1163heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 1287heterozygoteCFTR-RD-causing- Undef
varying clinical consequence- Undef
CBAVD 1276heterozygoteCFTR-RD-causing- Undef
CFTR-RD-causing- Undef
CBAVD 1256heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 5181heterozygoteVUS3- Undef
CF-causing- Undef
VUS3- Undef
CBAVD 1056heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 1052heterozygotevarying clinical consequence- Undef
varying clinical consequence- Undef
CBAVD 728heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 834heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 710heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 837heterozygotevarying clinical consequence- Undef
CF-causing- Undef
CBAVD 840heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 857heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 858heterozygote
CBAVD 690heterozygote
CBAVD 720heterozygoteCFTR-RD-causing- Undef
CBAVD 818heterozygote
CBAVD 737heterozygotevarying clinical consequence- Undef
CF-causing- Undef
CBAVD 746heterozygoteCFTR-RD-causing- Undef
CBAVD 763heterozygoteVUS3- Undef
CF-causing- Undef
CBAVD 765heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 781heterozygoteCFTR-RD-causing- Undef
CBAVD 786heterozygotevarying clinical consequence- Undef
CF-causing- Undef
CBAVD 724heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 721heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 805heterozygoteVUS3- Undef
CBAVD 806heterozygoteVUS3- Undef
CBAVD 812heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 868heterozygoteCF-causing- Undef
likely CFTR-RD- Undef
CBAVD 938heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 900heterozygoteVUS3- Undef
CF-causing- Undef
CBAVD 675heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 912heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 664heterozygote
CBAVD 931heterozygoteCFTR-RD-causing - Cis
CF-causing - Trans
CBAVD 894heterozygotevarying clinical consequence- Undef
VUS3- Undef
CBAVD 887heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 717heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 892heterozygotevarying clinical consequence- Undef
VUS3- Undef
CBAVD 676heterozygoteCFTR-RD-causing- Undef
CBAVD 893heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 682heterozygoteVUS3- Undef
CF-causing- Undef
CBAVD 1132homozygotec.3208C>T - p.(Arg1070Trp) - Trans
c.509G>A - p.(Arg170His) - Trans
CBAVD 725homozygotec.1210-34_1210-6TG[11]T[5] - Trans
c.1684G>A - p.(Val562Ile) - Trans
c.3846G>A - p.(Trp1282*) - Trans
CBAVD 656homozygotec.1210-34_1210-6TG[13]T[5] - Trans
c.2988+1G>A - p.(=) - Trans
CBAVD 701homozygotec.350G>A - p.(Arg117His) - Trans
CBAVD 1264homozygotec.1210-34_1210-6TG[13]T[5] - Trans
c.1521_1523del - p.(Phe508del) - Trans
CBAVD 613homozygotec.2657+5G>A - p.(=) - Trans
c.581G>T - p.(Gly194Val) - Trans
CBAVD 1281homozygotec.1210-34_1210-6TG[13]T[5] - Trans
CBAVD 633homozygotec.350G>A - p.(Arg117His) - Trans
c.3G>A - p.? - Trans
CBAVD 4646homozygotec.1327G>T - p.(Asp443Tyr) - Trans
c.680T>G - p.(Leu227Arg) - Trans
CBAVD 5945homozygotec.1657C>T - p.(Arg553*) - Trans
c.350G>A - p.(Arg117His) - Trans
CBAVD 395homozygotec.1327G>T - p.(Asp443Tyr) - Trans
c.2051_2052delinsG - p.(Lys684Serfs*38) - Trans
CBAVD 881homozygotec.1210-34_1210-6TG[11]T[5] - Trans
c.617T>G - p.(Leu206Trp) - Trans
CBAVD 5314homozygotec.1210-34_1210-6TG[11]T[5] - Trans
c.2195T>G - p.(Leu732*) - Trans
CBAVD 5325homozygotec.1210-34_1210-6TG[13]T[5] - Trans
c.769G>T - p.(Glu257*) - Trans
CBAVD 5766homozygotec.1210-34_1210-6TG[13]T[5] - Trans
c.350G>A - p.(Arg117His) - Trans
CBAVD 443homozygote
CBAVD 440homozygotec.1210-34_1210-6TG[11]T[5] - Trans
CBAVD 919homozygotec.1210-34_1210-6TG[11]T[5] - Trans
c.1684G>A - p.(Val562Ile) - Trans
c.3846G>A - p.(Trp1282*) - Trans
CBAVD 908homozygotec.1210-34_1210-6TG[11]T[5] - Trans
c.1466C>T - p.(Ser489Leu) - Trans
c.1684G>A - p.(Val562Ile) - Trans
CBAVD 391homozygotec.1210-34_1210-6TG[12]T[5] - Trans
c.1521_1523del - p.(Phe508del) - Trans
c.3199G>A - p.(Ala1067Thr) - Trans
CBAVD 520homozygotec.1521_1523del - p.(Phe508del) - Trans
c.350G>A - p.(Arg117His) - Trans
CBAVD 551homozygotec.1585-1G>A - p.(=) - Trans
c.3458T>A - p.(Val1153Glu) - Trans
CBAVD 5330homozygotec.1521_1523del - p.(Phe508del) - Trans
c.349C>G - p.(Arg117Gly) - Trans
CBAVD 548homozygotec.1521_1523del - p.(Phe508del) - Trans
c.617T>G - p.(Leu206Trp) - Trans
CBAVD 5592homozygotec.1210-34_1210-6TG[12]T[5] - Trans
c.233dup - p.(Trp79Leufs*32) - Trans
Other 4686heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Other 4695heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Other 4698heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Other 4835heterozygoteCFTR-RD-causing- Undef
VUS3- Undef
Other 87heterozygotevarying clinical consequence- Undef
CF-causing- Undef
Other 5083heterozygoteVUS3- Undef
CF-causing- Undef
Other 464heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Other 789heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
Other 935heterozygoteCFTR-RD-causing- Undef
Other 940heterozygoteCF-causing- Undef
Other 972heterozygoteCF-causing- Undef
Other 4826heterozygoteCFTR-RD-causing- Undef
CFTR-RD-causing- Undef
Other 5087heterozygoteCFTR-RD-causing- Undef
VUS3- Undef
Other 5243heterozygoteVUS3- Undef
Other 5264heterozygoteVUS3- Undef
CF-causing- Undef
Other 5743heterozygoteCF-causing- Undef
VUS3- Undef
CFTR-RD-causing- Undef
Other 5224heterozygoteVUS3- Undef
CFTR-RD-causing- Undef
Other 5825heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Other 4777heterozygoteCF-causing- Undef
VUS3- Undef
Other 4783heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Other 4800heterozygoteVUS3- Undef
CF-causing- Undef
VUS3- Undef
varying clinical consequence- Undef
Other 5184heterozygoteVUS3- Undef
CF-causing- Undef
VUS3- Undef
varying clinical consequence- Undef
Other 1069heterozygoteCF-causing- Undef
likely CFTR-RD- Undef
Other 5201heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
Other 1134heterozygotevarying clinical consequence- Undef
CF-causing- Undef
Other 2277heterozygoteCF-causing- Undef
Other 2433heterozygoteVUS3- Undef
Other 2434heterozygoteCF-causing- Undef
Other 2544heterozygotevarying clinical consequence- Undef
CF-causing- Undef
Other 1576heterozygoteCF-causing- Undef
VUS3- Undef
Other 2696heterozygoteCFTR-RD-causing- Undef
varying clinical consequence- Undef
Other 5575heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Other 2829heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
Other 2906heterozygotevarying clinical consequence - Cis
CFTR-RD-causing - Trans
Other 3047heterozygoteCF-causing - Trans
Other 3141heterozygoteCFTR-RD-causing - Cis
CF-causing - Trans
Other 3167heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
Other 3246heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
Other 3247heterozygotevarying clinical consequence- Undef
CF-causing- Undef
Other 3397heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
Other 5175heterozygoteCF-causing- Undef
VUS3- Undef
Other 5763heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
non-CF- Undef
Other 6438heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
VUS3- Undef
Other 5567heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
Other 5775heterozygoteCF-causing- Undef
VUS3- Undef
VUS3- Undef
Other 3539heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
Other 3608heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Other 3660heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Other 4244heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Other 4257heterozygoteVUS3- Undef
Other 4278heterozygoteVUS3- Undef
CF-causing- Undef
VUS1- Undef
Other 4293heterozygote
Other 4312heterozygoteCF-causing- Undef
VUS2- Undef
Other 4520heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Other 4528heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Other 4570heterozygoteVUS3- Undef
CF-causing- Undef
Other 4572heterozygoteVUS2- Undef
Other 4583heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Other 4587heterozygote
Other 4615heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
Other 4671homozygotec.1585-9449C>A - p.(=) - Trans
Other 1184homozygotec.1210-12T[5] - Trans
c.350G>A - p.(Arg117His) - Trans
Other 4760homozygotec.1163C>T - p.(Thr388Met) - Trans
Other 4625homozygotec.721G>T - p.(Gly241Trp) - Trans
Other 5967homozygotec.2780T>C - p.(Leu927Pro) - Trans
c.870-1113_870-1110del - p.(=) - Trans
Pancreatitis 4692heterozygotevarying clinical consequence- Undef
CFTR-RD-causing- Undef
Pancreatitis 4708heterozygoteCFTR-RD-causing- Undef
VUS3- Undef
Pancreatitis 648heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Pancreatitis 4789heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Pancreatitis 1063heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Pancreatitis 1161heterozygoteCF-causing- Undef
VUS3- Undef
Pancreatitis 1168heterozygote
Pancreatitis 4849heterozygoteCF-causing - Cis
CF-causing - Trans
Pancreatitis 2285heterozygoteCFTR-RD-causing- Undef
Pancreatitis 2306heterozygoteCFTR-RD-causing- Undef
Pancreatitis 2312heterozygoteCFTR-RD-causing- Undef
Pancreatitis 2318heterozygote
Pancreatitis 2319heterozygote
Pancreatitis 2321heterozygote
Pancreatitis 2322heterozygote
Pancreatitis 2324heterozygoteCFTR-RD-causing- Undef
Pancreatitis 2325heterozygoteCFTR-RD-causing- Undef
Pancreatitis 2326heterozygoteCFTR-RD-causing- Undef
Pancreatitis 2329heterozygoteVUS1- Undef
Pancreatitis 2338heterozygoteVUS3- Undef
Pancreatitis 2364heterozygote
Pancreatitis 2377heterozygoteCF-causing- Undef
Pancreatitis 2408heterozygote
Pancreatitis 2414heterozygote
Pancreatitis 2417heterozygoteCFTR-RD-causing- Undef
varying clinical consequence- Undef
Pancreatitis 2422heterozygote
Pancreatitis 2471heterozygoteVUS3- Undef
non-CF- Undef
Pancreatitis 2473heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Pancreatitis 2483heterozygoteCFTR-RD-causing- Undef
Pancreatitis 2486heterozygoteCFTR-RD-causing- Undef
non-CF- Undef
CFTR-RD-causing- Undef
Pancreatitis 2488heterozygoteCFTR-RD-causing- Undef
Pancreatitis 2528heterozygote
Pancreatitis 2591heterozygoteCFTR-RD-causing- Undef
CFTR-RD-causing- Undef
Pancreatitis 2302heterozygote
Pancreatitis 2748heterozygoteCFTR-RD-causing- Undef
Pancreatitis 2811heterozygoteCFTR-RD-causing - Trans
Pancreatitis 2907heterozygoteCFTR-RD-causing - Trans
Pancreatitis 2919heterozygoteCFTR-RD-causing - Cis
CFTR-RD-causing - Trans
Pancreatitis 2978heterozygoteCFTR-RD-causing- Undef
Pancreatitis 3009heterozygoteCFTR-RD-causing - Cis
VUS1 - Trans
Pancreatitis 3016heterozygotevarying clinical consequence - Trans
Pancreatitis 3023heterozygoteCFTR-RD-causing- Undef
Pancreatitis 3044heterozygoteCFTR-RD-causing- Undef
Pancreatitis 3061heterozygoteCFTR-RD-causing- Undef
Pancreatitis 3072heterozygoteCF-causing- Undef
Pancreatitis 3182heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Pancreatitis 3224heterozygoteCFTR-RD-causing- Undef
CFTR-RD-causing- Undef
VUS3- Undef
Pancreatitis 3232heterozygoteVUS1- Undef
Pancreatitis 3259heterozygotevarying clinical consequence- Undef
CF-causing- Undef
Pancreatitis 4619heterozygoteCFTR-RD-causing- Undef
VUS3- Undef
Pancreatitis 4639heterozygoteVUS3- Undef
VUS3- Undef
Pancreatitis 3315heterozygoteVUS2- Undef
Pancreatitis 4642heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
Pancreatitis 4659heterozygoteVUS3- Undef
Pancreatitis 3399heterozygote
Pancreatitis 5973heterozygoteVUS3- Undef
VUS3- Undef
Pancreatitis 5974heterozygoteVUS3- Undef
Pancreatitis 5977heterozygoteVUS3- Undef
Pancreatitis 5165heterozygoteVUS3- Undef
VUS3- Undef
Pancreatitis 5171heterozygoteVUS3- Undef
VUS3- Undef
Pancreatitis 5155heterozygoteVUS3- Undef
VUS3- Undef
Pancreatitis 5329heterozygotevarying clinical consequence- Undef
Pancreatitis 5336heterozygoteVUS3- Undef
VUS3- Undef
Pancreatitis 5339heterozygotevarying clinical consequence- Undef
CFTR-RD-causing- Undef
Pancreatitis 5340heterozygoteVUS3- Undef
Pancreatitis 5605heterozygoteVUS2- Undef
Pancreatitis 5608heterozygoteVUS3- Undef
Pancreatitis 5614heterozygoteVUS3- Undef
Pancreatitis 5619heterozygoteVUS3- Undef
Pancreatitis 5621heterozygote
Pancreatitis 5949heterozygotevarying clinical consequence- Undef
CF-causing- Undef
Pancreatitis 4240heterozygoteCF-causing- Undef
VUS3- Undef
Pancreatitis 4250heterozygoteCFTR-RD-causing- Undef
Pancreatitis 4252heterozygote
Pancreatitis 4255heterozygote
Pancreatitis 4256heterozygote
Pancreatitis 4258heterozygote
Pancreatitis 4261heterozygoteCF-causing- Undef
likely CFTR-RD- Undef
Pancreatitis 4270heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Pancreatitis 4273heterozygote
Pancreatitis 4296heterozygote
Pancreatitis 4299heterozygotevarying clinical consequence- Undef
CF-causing- Undef
Pancreatitis 4301heterozygote
Pancreatitis 4318heterozygoteCFTR-RD-causing- Undef
CFTR-RD-causing- Undef
Pancreatitis 4581heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Pancreatitis 1225homozygotec.1624G>T - p.(Gly542*) - Trans
Pancreatitis 4743homozygotec.1521_1523del - p.(Phe508del) - Trans
c.350G>A - p.(Arg117His) - Trans
Pancreatitis 5154homozygotec.350G>A - p.(Arg117His) - Trans
c.509G>A - p.(Arg170His) - Trans
Pancreatitis 5332homozygote
Pancreatitis 5364homozygotec.3340G>C - p.(Val1114Leu) - Trans
Pending (NBS) 4694heterozygoteCF-causing- Undef
Pending (NBS) 590heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Pending (NBS) 646heterozygotevarying clinical consequence- Undef
CF-causing- Undef
Pending (NBS) 726heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Pending (NBS) 794heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Pending (NBS) 799heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Pending (NBS) 803heterozygoteVUS2- Undef
CF-causing- Undef
Pending (NBS) 951heterozygoteVUS2- Undef
CF-causing- Undef
likely CF- Undef
Pending (NBS) 991heterozygotevarying clinical consequence- Undef
Pending (NBS) 5247heterozygoteCFTR-RD-causing- Undef
VUS3- Undef
CF-causing- Undef
VUS1- Undef
Pending (NBS) 5820heterozygoteCF-causing- Undef
VUS3- Undef
CFTR-RD-causing- Undef
Pending (NBS) 5808heterozygoteCF-causing- Undef
VUS3- Undef
Pending (NBS) 5817heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Pending (NBS) 4769heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Pending (NBS) 5190heterozygoteCF-causing- Undef
VUS3- Undef
VUS3- Undef
varying clinical consequence- Undef
Pending (NBS) 1076heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Pending (NBS) 5202heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
VUS3- Undef
Pending (NBS) 1180heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Pending (NBS) 1255heterozygotevarying clinical consequence- Undef
CF-causing- Undef
Pending (NBS) 1312heterozygoteCF-causing- Undef
VUS3- Undef
Pending (NBS) 1547heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Pending (NBS) 2520heterozygoteCF-causing- Undef
Pending (NBS) 2877heterozygoteCFTR-RD-causing- Undef
Pending (NBS) 2964heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Pending (NBS) 5017heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
Pending (NBS) 4643heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
Pending (NBS) 4616heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
Pending (NBS) 4620heterozygotevarying clinical consequence- Undef
CF-causing- Undef
Pending (NBS) 4631heterozygotevarying clinical consequence- Undef
CF-causing- Undef
Pending (NBS) 4654heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Pending (NBS) 6457heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Pending (NBS) 5566heterozygoteCF-causing - Cis
CFTR-RD-causing - Trans
Pending (NBS) 5342heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Pending (NBS) 5609heterozygoteVUS3- Undef
CF-causing- Undef
Pending (NBS) 5951heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Pending (NBS) 5570heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
Pending (NBS) 3884heterozygotevarying clinical consequence - Cis
CF-causing - Trans
Pending (NBS) 4119heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
Pending (NBS) 4174heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Pending (NBS) 4266heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Pending (NBS) 4803heterozygoteCF-causing- Undef
Pending (NBS) 4407heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Pending (NBS) 4508heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Pending (NBS) 4555heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
Pending (NBS) 4569heterozygotevarying clinical consequence- Undef
CF-causing- Undef
Pending (NBS) 4644homozygotec.1209G>C - p.(Glu403Asp) - Trans
c.2657+5G>A - p.(=) - Trans
Pending (NBS) 4645homozygotec.1000C>T - p.(Arg334Trp) - Trans
c.490A>C - p.(Thr164Pro) - Trans
Pending (NBS) 3478homozygotec.2657+66C>T - p.(=) - Trans
c.3472C>T - p.(Arg1158*) - Trans
c.350G>A - p.(Arg117His) - Trans
Bronchiectasis 4725heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
Bronchiectasis 4726heterozygoteCFTR-RD-causing- Undef
varying clinical consequence- Undef
Bronchiectasis 966heterozygoteVUS3- Undef
VUS3- Undef
Bronchiectasis 5126heterozygoteVUS3- Undef
Bronchiectasis 5530heterozygoteCFTR-RD-causing- Undef
CFTR-RD-causing- Undef
Bronchiectasis 1068heterozygoteCF-causing- Undef
likely CFTR-RD- Undef
Bronchiectasis 1096heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Bronchiectasis 1110heterozygotelikely CFTR-RD- Undef
Bronchiectasis 1120heterozygotevarying clinical consequence- Undef
Bronchiectasis 1197heterozygoteCF-causing- Undef
Bronchiectasis 1237heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
Bronchiectasis 4868heterozygotevarying clinical consequence- Undef
CF-causing- Undef
varying clinical consequence- Undef
Bronchiectasis 4870heterozygoteCFTR-RD-causing- Undef
CFTR-RD-causing- Undef
CFTR-RD-causing- Undef
Bronchiectasis 2287heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Bronchiectasis 2289heterozygoteCFTR-RD-causing- Undef
Bronchiectasis 2291heterozygoteCFTR-RD-causing- Undef
Bronchiectasis 2298heterozygoteCFTR-RD-causing- Undef
Bronchiectasis 2304heterozygoteCF-causing- Undef
Bronchiectasis 2307heterozygoteCF-causing- Undef
Bronchiectasis 2340heterozygoteCFTR-RD-causing- Undef
Bronchiectasis 2342heterozygoteCFTR-RD-causing- Undef
VUS3- Undef
Bronchiectasis 2344heterozygoteCFTR-RD-causing- Undef
Bronchiectasis 2367heterozygoteCFTR-RD-causing- Undef
Bronchiectasis 2373heterozygoteVUS3- Undef
Bronchiectasis 2406heterozygoteCFTR-RD-causing- Undef
Bronchiectasis 2409heterozygoteCF-causing- Undef
VUS3- Undef
Bronchiectasis 2419heterozygoteCFTR-RD-causing- Undef
non-CF- Undef
Bronchiectasis 2420heterozygoteCF-causing- Undef
Bronchiectasis 2424heterozygote
Bronchiectasis 2446heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Bronchiectasis 2502heterozygoteCFTR-RD-causing- Undef
CFTR-RD-causing- Undef
VUS3- Undef
Bronchiectasis 2526heterozygoteCF-causing- Undef
Bronchiectasis 2590heterozygoteCF-causing- Undef
Bronchiectasis 2960heterozygoteCFTR-RD-causing - Trans
Bronchiectasis 2988heterozygoteCFTR-RD-causing- Undef
varying clinical consequence- Undef
CF-causing- Undef
Bronchiectasis 3038heterozygoteCFTR-RD-causing - Cis
Bronchiectasis 3240heterozygotevarying clinical consequence- Undef
CF-causing- Undef
Bronchiectasis 4623heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Bronchiectasis 4657heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Bronchiectasis 5005heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
Bronchiectasis 5331heterozygoteVUS3- Undef
Bronchiectasis 5624heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Bronchiectasis 5589heterozygoteVUS3 - Cis
CFTR-RD-causing - Trans
Bronchiectasis 4308heterozygote
Bronchiectasis 4811heterozygoteCF-causing- Undef
Bronchiectasis 4816heterozygote
Bronchiectasis 4474heterozygotevarying clinical consequence- Undef
Bronchiectasis 4488heterozygotevarying clinical consequence- Undef
Bronchiectasis 4601heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
Bronchiectasis 4602heterozygoteCFTR-RD-causing- Undef
varying clinical consequence- Undef
Bronchiectasis 693homozygotec.137C>A - p.(Ala46Asp) - Trans
c.350G>A - p.(Arg117His) - Trans
c.580-92T>A - p.(=) - Trans
Bronchiectasis 777homozygotec.1210-34_1210-6TG[11]T[5] - Trans
c.1684G>A - p.(Val562Ile) - Trans
Bronchiectasis 5972homozygotec.1210-34_1210-6TG[11]T[5] - Trans
c.870-1113_870-1110del - p.(=) - Trans
Bronchiectasis 6435homozygotec.1210-34_1210-6TG[11]T[5] - Trans
c.870-1113_870-1110del - p.(=) - Trans
Bronchiectasis 6436homozygotec.3303G>A - p.(Met1101Ile) - Trans
Fetal bowel anomalies 4738heterozygoteCFTR-RD-causing- Undef
Fetal bowel anomalies 2397heterozygoteCFTR-RD-causing- Undef
CFTR-RD-causing- Undef
VUS3- Undef
Fetal bowel anomalies 2535heterozygoteCF-causing- Undef
Fetal bowel anomalies 5604heterozygoteVUS3- Undef
Asymptomatic compound heterozygote 5073heterozygote
Asymptomatic compound heterozygote 5077heterozygoteVUS3- Undef
Asymptomatic compound heterozygote 558heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
Asymptomatic compound heterozygote 922heterozygote
Asymptomatic compound heterozygote 5144heterozygoteVUS3- Undef
VUS3- Undef
Asymptomatic compound heterozygote 5140heterozygoteVUS3- Undef
CF-causing- Undef
Asymptomatic compound heterozygote 1290heterozygoteCFTR-RD-causing- Undef
Asymptomatic compound heterozygote 3083heterozygote
Asymptomatic compound heterozygote 3235heterozygoteCFTR-RD-causing - Cis
CFTR-RD-causing - Trans
Asymptomatic compound heterozygote 4628heterozygoteVUS3- Undef
CFTR-RD-causing- Undef
Asymptomatic compound heterozygote 4656heterozygoteVUS3- Undef
VUS3- Undef
Asymptomatic compound heterozygote 4763heterozygoteCF-causing- Undef
Asymptomatic compound heterozygote 6434heterozygoteCFTR-RD-causing- Undef
VUS3- Undef
Asymptomatic compound heterozygote 6437heterozygoteCFTR-RD-causing- Undef
VUS3- Undef
Asymptomatic compound heterozygote 6440heterozygotevarying clinical consequence- Undef
CF-causing- Undef
Asymptomatic compound heterozygote 5167heterozygotevarying clinical consequence- Undef
Asymptomatic compound heterozygote 5333heterozygotenon-CF- Undef
CFTR-RD-causing- Undef
Asymptomatic compound heterozygote 5598heterozygoteCF-causing- Undef
non-CF- Undef
Asymptomatic compound heterozygote 5601heterozygoteCF-causing- Undef
Asymptomatic compound heterozygote 5602heterozygoteVUS3- Undef
VUS3- Undef
Asymptomatic compound heterozygote 5606heterozygoteCFTR-RD-causing- Undef
non-CF- Undef
CF-causing- Undef
Asymptomatic compound heterozygote 5964heterozygoteVUS3- Undef
CF-causing- Undef
Asymptomatic compound heterozygote 5164heterozygoteCF-causing- Undef
Asymptomatic compound heterozygote 4260heterozygoteVUS3- Undef
CFTR-RD-causing- Undef
Asymptomatic compound heterozygote 4303heterozygoteCFTR-RD-causing- Undef
Asymptomatic compound heterozygote 4522heterozygoteCF-causing- Undef
VUS3- Undef
Asymptomatic compound heterozygote 5081homozygote
Asymptomatic compound heterozygote 5141homozygotec.2756A>G - p.(Tyr919Cys) - Trans
Asymptomatic compound heterozygote 5177homozygotec.2756A>G - p.(Tyr919Cys) - Trans
Asymptomatic compound heterozygote 5218homozygotec.1210-34_1210-6TG[11]T[5] - Trans
c.2758G>T - p.(Val920Leu) - Trans
c.3409A>G - p.(Met1137Val) - Trans
Asymptomatic compound heterozygote 5525homozygotec.4275T>A - p.(Asp1425Glu) - Trans
Asymptomatic compound heterozygote 5818homozygotec.1210-34_1210-6TG[11]T[5] - Trans
Asymptomatic compound heterozygote 4741homozygotec.489+3A>G - p.(=) - Trans
Asymptomatic compound heterozygote 5362homozygotec.1696G>A - p.(Ala566Thr) - Trans
c.2743G>C - p.(Val915Leu) - Trans
Pending 243heterozygote
Pending 312heterozygoteCFTR-RD-causing- Undef
Pending 1075heterozygoteCF-causing- Undef
Pending 1097heterozygoteVUS3 - Cis
varying clinical consequence - Trans
Pending 1155heterozygoteCF-causing- Undef
VUS3- Undef
Pending 3073heterozygoteCF-causing- Undef
VUS3- Undef
Pending 3089heterozygote
Pending 3165heterozygoteCFTR-RD-causing- Undef
varying clinical consequence- Undef
Pending 4304heterozygoteVUS3 - Cis
Pending 5008homozygotec.2657+5G>A - p.(=) - Trans
c.2988+1G>A - p.(=) - Trans
CRS-NP 349heterozygotevarying clinical consequence - Cis
CF-causing - Trans
VUS1- Undef
CRS-NP 5138heterozygotenon-CF- Undef
CRS-NP 3078heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CRS-NP 3088heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CRS-NP 4649heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CRS-NP 3126heterozygoteCFTR-RD-causing- Undef
CFTR-RD-causing- Undef
CRS-NP 3161heterozygoteCF-causing- Undef
VUS3- Undef
varying clinical consequence- Undef
CRS-NP 6442heterozygoteCFTR-RD-causing- Undef
VUS3- Undef
CRS-NP 4805heterozygote
Pending non-CF 4825heterozygoteVUS3- Undef
varying clinical consequence- Undef
Pending non-CF 3094heterozygoteCFTR-RD-causing- Undef
varying clinical consequence- Undef
Pending non-CF 5009heterozygoteVUS3- Undef
CF-causing- Undef
Aquagenic palmoplantar keratoderma 5822heterozygoteCFTR-RD-causing- Undef
non-CF- Undef
Aquagenic palmoplantar keratoderma 5149heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Aquagenic palmoplantar keratoderma 5613heterozygotenon-CF- Undef
Aquagenic palmoplantar keratoderma 4660homozygotec.2657+5G>A - p.(=) - Trans
Aquagenic palmoplantar keratoderma 5772homozygotec.4139C>T - p.(Thr1380Ile) - Trans


Color code:   non disease-causing <   likely benign <   VUS <   likely pathogenic <   disease-causing



            CFTR variants are clustered into five groups (click here for more details about the classification of variants):
  • CF-causing: when in trans with another CF-causing mutation, will result in CF.
  • CFTR-RD causing: when in trans with a CF-causing mutation, will result in CFTR-related disorders (CFTR-RD) such as chronic pancreatitis, bronchiectasis, CRS-NP (chronic rhinosinusitis with or without nasal polyposis) or CBAVD (congenital absence of vas deferens), according to Bombieri C et al., 2011.
  • Varying clinical consequence: when in trans with another CF-causing mutation, can either result in CF or in a CFTR-RD.
  • Non disease-causing: when in trans with a CF-causing mutation, will not cause CF, nor CFTR-RD.
  • VUS (Variant of unknown clinical significance): unclassified because of insufficient data.



Go to CFTRare