Variant NM_000492.4:c.1680-870T>A
| Name | NM_000492.4:c.1680-870T>A |
| Protein name | NP_000483.3:p.(=) |
| Genomic name (hg19) | chr7:g.117229537T>A UCSC |
| Genomic name (hg38) | chr7:g.117589483T>A UCSC |
| #Exon/intron | intron 12 |
| Legacy Name | 1811+1650T>A |
| Class | non disease-causing |
| WT sequence | ACTTGAGATATAAGTAAGGTTACTA T CAATCACACCTGAAAAATTTAAATG |
| Mutant sequence | ACTTGAGATATAAGTAAGGTTACTA A CAATCACACCTGAAAAATTTAAATG |
![]() | ![]() Not found | dbSNP rs213965 |
![]() Not found | ![]() |
112 individuals carrying this variant are reported in CFTR-NGS catalogue |
| TOTAL NUMBER OF PATIENTS | 404 |
|---|---|
| Asymptomatic compound heterozygote | 26 |
| CF | 90 |
| CFTR-RD | 244
|
| Fetal bowel anomalies | 2 |
| Pending | 3 |
| Pending (NBS) | 36 |
| Pending non-CF | 3 |
| Color code: non disease-causing < likely benign < VUS < likely pathogenic < disease-causing |
| Phenotype | Patient ID | Variant status | Additional variants |
|---|---|---|---|
| CF | 5189 | heterozygote | CF-causing- Undef varying clinical consequence- Undef VUS3- Undef |
| CF | 5186 | heterozygote | CF-causing- Undef varying clinical consequence- Undef VUS3- Undef |
| CF | 5185 | heterozygote | CF-causing- Undef CF-causing- Undef VUS3- Undef |
| CF | 4791 | heterozygote | CF-causing- Undef CF-causing- Undef VUS3- Undef |
| CF | 3282 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 5016 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
| CF | 2893 | heterozygote | CF-causing- Undef CF-causing- Undef VUS3- Undef |
| CF | 926 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
| CF | 924 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 913 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
| CF | 5256 | heterozygote | CF-causing- Undef VUS2- Undef CF-causing- Undef |
| CF | 5089 | heterozygote | varying clinical consequence- Undef CF-causing- Undef |
| CF | 4962 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef |
| CF | 5215 | heterozygote | CFTR-RD-causing- Undef VUS3- Undef |
| CF | 5328 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 5615 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 5335 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 5963 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 5767 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 5006 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 4764 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 5168 | heterozygote | CF-causing- Undef VUS3- Undef CF-causing- Undef VUS3- Undef |
| CF | 6456 | heterozygote | CF-causing- Undef varying clinical consequence- Undef VUS3- Undef |
| CF | 816 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 762 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 761 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 4719 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
| CF | 4732 | heterozygote | varying clinical consequence- Undef CF-causing- Undef |
| CF | 787 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
| CF | 668 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 672 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 711 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 681 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 703 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 686 | heterozygote | VUS3- Undef |
| CF | 696 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef CF-causing- Undef |
| CF | 688 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 666 | heterozygote | CF-causing- Undef CF-causing- Undef VUS3- Undef |
| CF | 745 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 744 | heterozygote | VUS3- Undef |
| CF | 738 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 733 | heterozygote | CF-causing- Undef VUS3- Undef |
| CF | 884 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 4697 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 907 | heterozygote | CF-causing- Undef likely CF- Undef |
| CF | 829 | heterozygote | CF-causing- Undef varying clinical consequence- Undef VUS3- Undef |
| CF | 3969 | homozygote | c.1521_1523del - p.(Phe508del) - Trans c.2988+1173_3468+2111del - p.(Leu997_Leu1156del) - Trans |
| CF | 6441 | homozygote | c.1364C>A - p.(Ala455Glu) - Trans c.1657C>T - p.(Arg553*) - Trans |
| CF | 6453 | homozygote | c.1521_1523del - p.(Phe508del) - Trans c.870-1113_870-1110del - p.(=) - Trans |
| CF | 6439 | homozygote | c.1521_1523del - p.(Phe508del) - Trans c.2490+1G>A - p.(=) - Trans |
| CF | 4629 | homozygote | c.137C>A - p.(Ala46Asp) - Trans c.1521_1523del - p.(Phe508del) - Trans c.580-92T>A - p.(=) - Trans |
| CF | 5777 | homozygote | c.1210-34_1210-6TG[11]T[5] - Trans c.1652G>A - p.(Gly551Asp) - Trans c.3532_3535dup - p.(Thr1179IlefsTer17) - Trans |
| CF | 6432 | homozygote | c.1853T>A - p.(Ile618Asn) - Trans c.3472C>T - p.(Arg1158*) - Trans |
| CF | 5971 | homozygote | c.1624G>T - p.(Gly542*) - Trans c.3644_3645delinsAT - p.(Leu1215His) - Trans |
| CF | 5965 | homozygote | c.1521_1523del - p.(Phe508del) - Trans c.3718-2477C>T - p.(=) - Trans |
| CF | 5345 | homozygote | c.1521_1523del - p.(Phe508del) - Trans c.870-1113_870-1110del - p.(=) - Trans |
| CF | 5622 | homozygote | c.1521_1523del - p.(Phe508del) - Trans c.617T>G - p.(Leu206Trp) - Trans |
| CF | 5341 | homozygote | c.296C>G - p.(Pro99Arg) - Trans c.3846G>A - p.(Trp1282*) - Trans |
| CF | 663 | homozygote | c.1399C>T - p.(Leu467Phe) - Trans c.1521_1523del - p.(Phe508del) - Trans c.870-1113_870-1110del - p.(=) - Trans |
| CF | 316 | homozygote | c.1657C>T - p.(Arg553*) - Trans c.870-1113_870-1110del - p.(=) - Trans |
| CF | 5948 | homozygote | c.1521_1523del - p.(Phe508del) - Trans c.171G>A - p.(Trp57*) - Trans |
| CF | 4688 | homozygote | c.1519_1521del - p.(Ile507del) - Trans c.2657+5G>A - p.(=) - Trans |
| CF | 5770 | homozygote | c.1853T>A - p.(Ile618Asn) - Trans c.3472C>T - p.(Arg1158*) - Trans |
| CF | 4718 | homozygote | c.2374C>T - p.(Arg792*) - Trans c.870-1113_870-1110del - p.(=) - Trans |
| CF | 5174 | homozygote | c.1521_1523del - p.(Phe508del) - Trans c.870-1113_870-1110del - p.(=) - Trans |
| CF | 835 | homozygote | c.1521_1523del - p.(Phe508del) - Trans c.2241_2248del - p.(Ile748Serfs*28) - Trans |
| CF | 808 | homozygote | c.3909C>G - p.(Asn1303Lys) - Trans c.870-1113_870-1110del - p.(=) - Trans |
| CF | 909 | homozygote | c.1624G>T - p.(Gly542*) - Trans c.870-1113_870-1110del - p.(=) - Trans |
| CF | 4665 | homozygote | c.1555A>G - p.(Ser519Gly) - Trans |
| CF | 4796 | homozygote | c.*133T>A - p.(=) - Trans c.1624G>T - p.(Gly542*) - Trans c.54-589A>G - p.(=) - Trans c.870-1113_870-1110del - p.(=) - Trans |
| CF | 945 | homozygote | c.1521_1523del - p.(Phe508del) - Trans c.3617C>A - p.(Ser1206*) - Trans |
| CF | 943 | homozygote | c.1040G>A - p.(Arg347His) - Trans c.1521_1523del - p.(Phe508del) - Trans |
| CF | 930 | homozygote | c.3909C>G - p.(Asn1303Lys) - Trans |
| CF | 901 | homozygote | c.2657+5G>A - p.(=) - Trans |
| CF | 920 | homozygote | c.1399C>T - p.(Leu467Phe) - Trans c.1521_1523del - p.(Phe508del) - Trans c.3160C>G - p.(His1054Asp) - Trans |
| CF | 947 | homozygote | c.1521_1523del - p.(Phe508del) - Trans c.870-1113_870-1110del - p.(=) - Trans |
| CF | 882 | homozygote | c.1518C>G - p.(Ile506Met) - Trans c.1521_1523del - p.(Phe508del) - Trans |
| CF | 5807 | homozygote | c.1475C>T - p.(Ser492Phe) - Trans c.222_223delinsA - p.(Arg75AspfsTer16) - Trans |
| CF | 863 | homozygote | c.1521_1523del - p.(Phe508del) - Trans c.1705T>G - p.(Tyr569Asp) - Trans |
| CF | 977 | homozygote | c.680T>G - p.(Leu227Arg) - Trans |
| CF | 975 | homozygote | c.1624G>T - p.(Gly542*) - Trans |
| CF | 5188 | homozygote | c.1792A>T - p.(Lys598*) - Trans |
| CF | 716 | homozygote | c.1521_1523del - p.(Phe508del) - Trans c.3822G>A - p.(Trp1274*) - Trans |
| CF | 691 | homozygote | c.148T>C - p.(Ser50Pro) - Trans c.1521_1523del - p.(Phe508del) - Trans |
| CF | 4747 | homozygote | c.1521_1523del - p.(Phe508del) - Trans c.2443del - p.(Glu815Lysfs*6) - Trans |
| CF | 4744 | homozygote | c.1521_1523del - p.(Phe508del) - Trans c.2816A>G - p.(His939Arg) - Trans |
| CF | 5067 | homozygote | c.1521_1523del - p.(Phe508del) - Trans c.3874-4522A>G - p.(=) - Trans |
| CF | 1140 | homozygote | c.1521_1523del - p.(Phe508del) - Trans c.3964-78_4242+577del - p.(Gly1323_Val1415del) - Trans |
| CF | 730 | homozygote | c.3131A>G - p.(Glu1044Gly) - Trans |
| CF | 3275 | homozygote | c.1521_1523del - p.(Phe508del) - Trans c.1647T>G - p.(Ser549Arg) - Trans c.4137-136A>G - p.(=) - Trans |
| Other | 5187 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef |
| Other | 5184 | heterozygote | VUS3- Undef CF-causing- Undef VUS3- Undef varying clinical consequence- Undef |
| Other | 4799 | heterozygote | CF-causing- Undef varying clinical consequence- Undef VUS3- Undef |
| Other | 6343 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
| Other | 5201 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef |
| Other | 3046 | heterozygote | likely CFTR-RD- Undef |
| Other | 4762 | heterozygote | VUS3- Undef CF-causing- Undef |
| Other | 4664 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef |
| Other | 5518 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
| Other | 937 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
| Other | 935 | heterozygote | CFTR-RD-causing- Undef |
| Other | 980 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef varying clinical consequence- Undef |
| Other | 5743 | heterozygote | CF-causing- Undef VUS3- Undef CFTR-RD-causing- Undef |
| Other | 5087 | heterozygote | CFTR-RD-causing- Undef VUS3- Undef |
| Other | 4826 | heterozygote | CFTR-RD-causing- Undef CFTR-RD-causing- Undef |
| Other | 5163 | heterozygote | CF-causing- Undef VUS3- Undef |
| Other | 5616 | heterozygote | CFTR-RD-causing- Undef non-CF- Undef |
| Other | 5763 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef non-CF- Undef |
| Other | 6438 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef VUS3- Undef |
| Other | 4846 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef |
| Other | 4835 | heterozygote | CFTR-RD-causing- Undef VUS3- Undef |
| Other | 4836 | heterozygote | CF-causing- Undef VUS3- Undef |
| Other | 757 | heterozygote | varying clinical consequence- Undef CF-causing- Undef |
| Other | 756 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
| Other | 779 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
| Other | 789 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef |
| Other | 4686 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
| Other | 845 | heterozygote | CF-causing- Undef |
| Other | 4690 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
| Other | 4695 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
| Other | 4714 | heterozygote | CF-causing- Undef |
| Other | 4705 | heterozygote | CF-causing- Undef CF-causing- Undef |
| Other | 4671 | homozygote | c.1585-9449C>A - p.(=) - Trans |
| Other | 5967 | homozygote | c.2780T>C - p.(Leu927Pro) - Trans c.870-1113_870-1110del - p.(=) - Trans |
| Other | 5175 | homozygote | c.1521_1523del - p.(Phe508del) - Trans c.1630G>A - p.(Gly544Ser) - Trans |
| Other | 4698 | homozygote | c.1521_1523del - p.(Phe508del) - Trans c.2909-15T>G - p.(=) - Trans |
| Other | 5083 | homozygote | c.1327G>T - p.(Asp443Tyr) - Trans c.3909C>G - p.(Asn1303Lys) - Trans |
| Other | 5224 | homozygote | c.-274C>A - p.(=) - Trans c.1210-34_1210-6TG[11]T[5] - Trans |
| Other | 4800 | homozygote | c.*1251C>T - p.(=) - Trans c.1521_1523del - p.(Phe508del) - Trans c.54-589A>G - p.(=) - Trans c.617T>G - p.(Leu206Trp) - Trans |
| Other | 5825 | homozygote | c.1210-34_1210-6TG[11]T[5] - Trans c.1521_1523del - p.(Phe508del) - Trans |
| Other | 940 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
| Other | 972 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
| Other | 4760 | homozygote | c.1163C>T - p.(Thr388Met) - Trans |
| Other | 4625 | homozygote | c.721G>T - p.(Gly241Trp) - Trans |
| CBAVD | 5234 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef VUS3- Undef |
| CBAVD | 5181 | heterozygote | VUS3- Undef CF-causing- Undef VUS3- Undef |
| CBAVD | 5821 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
| CBAVD | 5022 | heterozygote | CFTR-RD-causing- Undef CFTR-RD-causing- Undef VUS3- Undef varying clinical consequence- Undef |
| CBAVD | 5015 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
| CBAVD | 4754 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef |
| CBAVD | 4753 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef |
| CBAVD | 4651 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef VUS3- Undef |
| CBAVD | 4650 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef |
| CBAVD | 4624 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef |
| CBAVD | 4653 | heterozygote | CFTR-RD-causing- Undef varying clinical consequence- Undef |
| CBAVD | 4755 | heterozygote | varying clinical consequence- Undef CF-causing- Undef |
| CBAVD | 941 | heterozygote | VUS4- Undef CF-causing- Undef |
| CBAVD | 938 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
| CBAVD | 931 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef |
| CBAVD | 927 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef |
| CBAVD | 918 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
| CBAVD | 986 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
| CBAVD | 5228 | heterozygote | CFTR-RD-causing- Undef VUS3- Undef |
| CBAVD | 5134 | heterozygote | VUS3- Undef CF-causing- Undef |
| CBAVD | 5809 | heterozygote | likely CFTR-RD- Undef VUS3- Undef |
| CBAVD | 5223 | heterozygote | CF-causing- Undef VUS3- Undef |
| CBAVD | 5764 | heterozygote | VUS3- Undef CF-causing- Undef |
| CBAVD | 5768 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef |
| CBAVD | 5765 | heterozygote | varying clinical consequence- Undef CF-causing- Undef |
| CBAVD | 5590 | heterozygote | VUS3- Undef CF-causing- Undef |
| CBAVD | 4750 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef |
| CBAVD | 5591 | heterozygote | CFTR-RD-causing- Undef varying clinical consequence- Undef |
| CBAVD | 6454 | heterozygote | CFTR-RD-causing- Undef non-CF- Undef CFTR-RD-causing- Undef |
| CBAVD | 5969 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
| CBAVD | 5968 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef |
| CBAVD | 774 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef |
| CBAVD | 4837 | heterozygote | CFTR-RD-causing- Undef varying clinical consequence- Undef |
| CBAVD | 4740 | heterozygote | CF-causing- Undef likely CFTR-RD- Undef |
| CBAVD | 812 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
| CBAVD | 810 | heterozygote | VUS2- Undef CF-causing- Undef CFTR-RD-causing- Undef |
| CBAVD | 805 | heterozygote | VUS3- Undef |
| CBAVD | 4735 | heterozygote | VUS3- Undef varying clinical consequence- Undef |
| CBAVD | 751 | heterozygote | CF-causing- Undef VUS3- Undef |
| CBAVD | 5072 | heterozygote | CF-causing- Undef VUS3- Undef |
| CBAVD | 676 | heterozygote | CFTR-RD-causing- Undef |
| CBAVD | 678 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
| CBAVD | 679 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef |
| CBAVD | 665 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
| CBAVD | 746 | heterozygote | CFTR-RD-causing- Undef |
| CBAVD | 4710 | heterozygote | CFTR-RD-causing- Undef VUS3- Undef CF-causing- Undef |
| CBAVD | 743 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
| CBAVD | 736 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef |
| CBAVD | 735 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
| CBAVD | 664 | heterozygote | |
| CBAVD | 712 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef |
| CBAVD | 690 | heterozygote | |
| CBAVD | 895 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef |
| CBAVD | 894 | heterozygote | varying clinical consequence- Undef VUS3- Undef |
| CBAVD | 841 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
| CBAVD | 856 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
| CBAVD | 876 | heterozygote | CF-causing- Undef likely CFTR-RD- Undef |
| CBAVD | 897 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
| CBAVD | 858 | heterozygote | |
| CBAVD | 859 | heterozygote | varying clinical consequence- Undef CF-causing- Undef |
| CBAVD | 687 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef |
| CBAVD | 873 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
| CBAVD | 875 | heterozygote | CF-causing- Undef likely CFTR-RD- Undef |
| CBAVD | 792 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
| CBAVD | 4682 | heterozygote | CF-causing- Undef VUS3- Undef CFTR-RD-causing- Undef |
| CBAVD | 891 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef |
| CBAVD | 4707 | heterozygote | varying clinical consequence- Undef CF-causing- Undef |
| CBAVD | 849 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef |
| CBAVD | 887 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
| CBAVD | 4699 | heterozygote | CFTR-RD-causing- Undef VUS2- Undef CF-causing- Undef |
| CBAVD | 892 | heterozygote | varying clinical consequence- Undef VUS3- Undef |
| CBAVD | 818 | heterozygote | |
| CBAVD | 806 | heterozygote | VUS3- Undef |
| CBAVD | 6455 | homozygote | c.1521_1523del - p.(Phe508del) - Trans c.638G>A - p.(Gly213Glu) - Trans |
| CBAVD | 4679 | homozygote | c.1521_1523del - p.(Phe508del) - Trans c.617T>G - p.(Leu206Trp) - Trans |
| CBAVD | 5344 | homozygote | c.1364C>A - p.(Ala455Glu) - Trans c.1521_1523del - p.(Phe508del) - Trans |
| CBAVD | 5346 | homozygote | c.1521_1523del - p.(Phe508del) - Trans c.2813T>G - p.(Val938Gly) - Trans |
| CBAVD | 5592 | homozygote | c.1210-34_1210-6TG[12]T[5] - Trans c.233dup - p.(Trp79Leufs*32) - Trans |
| CBAVD | 5944 | homozygote | c.1521_1523del - p.(Phe508del) - Trans c.2813T>G - p.(Val938Gly) - Trans |
| CBAVD | 682 | homozygote | c.1327G>T - p.(Asp443Tyr) - Trans c.1521_1523del - p.(Phe508del) - Trans |
| CBAVD | 675 | homozygote | c.1521_1523del - p.(Phe508del) - Trans c.350G>A - p.(Arg117His) - Trans |
| CBAVD | 5945 | homozygote | c.1657C>T - p.(Arg553*) - Trans c.350G>A - p.(Arg117His) - Trans |
| CBAVD | 5766 | homozygote | c.1210-34_1210-6TG[13]T[5] - Trans c.350G>A - p.(Arg117His) - Trans |
| CBAVD | 4706 | homozygote | c.1652G>A - p.(Gly551Asp) - Trans c.2939T>A - p.(Ile980Lys) - Trans |
| CBAVD | 4729 | homozygote | c.3160C>T - p.(His1054Tyr) - Trans c.3170C>G - p.(Thr1057Arg) - Trans |
| CBAVD | 5600 | homozygote | c.2735C>G - p.(Ser912Trp) - Trans |
| CBAVD | 5603 | homozygote | c.1521_1523del - p.(Phe508del) - Trans c.509G>A - p.(Arg170His) - Trans |
| CBAVD | 5946 | homozygote | c.1521_1523del - p.(Phe508del) - Trans c.4186A>C - p.(Thr1396Pro) - Trans |
| CBAVD | 4683 | homozygote | c.1327G>T - p.(Asp443Tyr) - Trans c.1521_1523del - p.(Phe508del) - Trans |
| CBAVD | 5314 | homozygote | c.1210-34_1210-6TG[11]T[5] - Trans c.2195T>G - p.(Leu732*) - Trans |
| CBAVD | 5325 | homozygote | c.1210-34_1210-6TG[13]T[5] - Trans c.769G>T - p.(Glu257*) - Trans |
| CBAVD | 5947 | homozygote | c.1327G>T - p.(Asp443Tyr) - Trans c.1521_1523del - p.(Phe508del) - Trans |
| CBAVD | 834 | homozygote | c.1521_1523del - p.(Phe508del) - Trans c.617T>G - p.(Leu206Trp) - Trans |
| CBAVD | 5229 | homozygote | c.1585-1G>A - p.(=) - Trans c.2939T>A - p.(Ile980Lys) - Trans |
| CBAVD | 786 | homozygote | c.1210-34_1210-6TG[13]T[5] - Trans c.1521_1523del - p.(Phe508del) - Trans |
| CBAVD | 837 | homozygote | c.1210-34_1210-6TG[13]T[5] - Trans c.1521_1523del - p.(Phe508del) - Trans |
| CBAVD | 893 | homozygote | c.1521_1523del - p.(Phe508del) - Trans c.350G>A - p.(Arg117His) - Trans |
| CBAVD | 900 | homozygote | c.1327G>T - p.(Asp443Tyr) - Trans c.1521_1523del - p.(Phe508del) - Trans |
| CBAVD | 919 | homozygote | c.1210-34_1210-6TG[11]T[5] - Trans c.1684G>A - p.(Val562Ile) - Trans c.3846G>A - p.(Trp1282*) - Trans |
| CBAVD | 908 | homozygote | c.1210-34_1210-6TG[11]T[5] - Trans c.1466C>T - p.(Ser489Leu) - Trans c.1684G>A - p.(Val562Ile) - Trans |
| CBAVD | 949 | homozygote | c.1210-34_1210-6TG[11]T[5] - Trans c.1521_1523del - p.(Phe508del) - Trans |
| CBAVD | 838 | homozygote | c.1521_1523del - p.(Phe508del) - Trans c.3415A>G - p.(Ile1139Val) - Trans |
| CBAVD | 840 | homozygote | c.1521_1523del - p.(Phe508del) - Trans c.617T>G - p.(Leu206Trp) - Trans |
| CBAVD | 857 | homozygote | c.1521_1523del - p.(Phe508del) - Trans c.617T>G - p.(Leu206Trp) - Trans |
| CBAVD | 978 | homozygote | c.1521_1523del - p.(Phe508del) - Trans c.617T>G - p.(Leu206Trp) - Trans |
| CBAVD | 881 | homozygote | c.1210-34_1210-6TG[11]T[5] - Trans c.617T>G - p.(Leu206Trp) - Trans |
| CBAVD | 912 | homozygote | c.1521_1523del - p.(Phe508del) - Trans c.617T>G - p.(Leu206Trp) - Trans |
| CBAVD | 5173 | homozygote | c.1521_1523del - p.(Phe508del) - Trans c.166G>A - p.(Glu56Lys) - Trans c.3080T>C - p.(Ile1027Thr) - Trans |
| CBAVD | 717 | homozygote | c.1521_1523del - p.(Phe508del) - Trans c.350G>A - p.(Arg117His) - Trans |
| CBAVD | 720 | homozygote | c.4097T>C - p.(Ile1366Thr) - Trans |
| CBAVD | 721 | homozygote | c.1521_1523del - p.(Phe508del) - Trans c.350G>A - p.(Arg117His) - Trans |
| CBAVD | 868 | homozygote | c.1521_1523del - p.(Phe508del) - Trans c.4225G>A - p.(Glu1409Lys) - Trans |
| CBAVD | 724 | homozygote | c.1521_1523del - p.(Phe508del) - Trans c.350G>A - p.(Arg117His) - Trans |
| CBAVD | 725 | homozygote | c.1210-34_1210-6TG[11]T[5] - Trans c.1684G>A - p.(Val562Ile) - Trans c.3846G>A - p.(Trp1282*) - Trans |
| CBAVD | 701 | homozygote | c.350G>A - p.(Arg117His) - Trans |
| CBAVD | 710 | homozygote | c.1521_1523del - p.(Phe508del) - Trans c.4276T>C - p.(Ser1426Pro) - Trans |
| CBAVD | 728 | homozygote | c.1521_1523del - p.(Phe508del) - Trans c.350G>A - p.(Arg117His) - Trans |
| CBAVD | 4756 | homozygote | c.1521_1523del - p.(Phe508del) - Trans c.3908A>T - p.(Asn1303Ile) - Trans |
| CBAVD | 4663 | homozygote | c.1210-34_1210-6TG[13]T[5] - Trans c.262_263del - p.(Leu88Ilefs*22) - Trans |
| CBAVD | 4622 | homozygote | c.1210-34_1210-6TG[13]T[5] - Trans c.1521_1523del - p.(Phe508del) - Trans |
| CBAVD | 4646 | homozygote | c.1327G>T - p.(Asp443Tyr) - Trans c.680T>G - p.(Leu227Arg) - Trans |
| CBAVD | 763 | homozygote | c.1327G>T - p.(Asp443Tyr) - Trans c.1521_1523del - p.(Phe508del) - Trans |
| CBAVD | 765 | homozygote | c.1521_1523del - p.(Phe508del) - Trans c.617T>G - p.(Leu206Trp) - Trans |
| CBAVD | 4761 | homozygote | c.1521_1523del - p.(Phe508del) - Trans c.349C>T - p.(Arg117Cys) - Trans |
| CBAVD | 4752 | homozygote | c.1327G>T - p.(Asp443Tyr) - Trans c.1521_1523del - p.(Phe508del) - Trans |
| CBAVD | 3267 | homozygote | c.-34C>T - p.(=) - Trans c.1521_1523del - p.(Phe508del) - Trans |
| CBAVD | 5068 | homozygote | c.1521_1523del - p.(Phe508del) - Trans c.3874-4522A>G - p.(=) - Trans |
| Pancreatitis | 964 | heterozygote | CFTR-RD-causing- Undef |
| Pancreatitis | 5145 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef |
| Pancreatitis | 5611 | heterozygote | CFTR-RD-causing- Undef VUS3- Undef |
| Pancreatitis | 5608 | heterozygote | VUS3- Undef |
| Pancreatitis | 5605 | heterozygote | VUS2- Undef |
| Pancreatitis | 5340 | heterozygote | VUS3- Undef |
| Pancreatitis | 5336 | heterozygote | VUS3- Undef VUS3- Undef |
| Pancreatitis | 5329 | heterozygote | varying clinical consequence- Undef |
| Pancreatitis | 5614 | heterozygote | VUS3- Undef |
| Pancreatitis | 5621 | heterozygote | |
| Pancreatitis | 5619 | heterozygote | VUS3- Undef |
| Pancreatitis | 5326 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef varying clinical consequence- Undef |
| Pancreatitis | 5339 | heterozygote | varying clinical consequence- Undef CFTR-RD-causing- Undef |
| Pancreatitis | 5010 | heterozygote | CFTR-RD-causing- Undef CFTR-RD-causing- Undef |
| Pancreatitis | 5007 | heterozygote | VUS3- Undef CF-causing- Undef |
| Pancreatitis | 4659 | heterozygote | VUS3- Undef |
| Pancreatitis | 4642 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef |
| Pancreatitis | 4639 | heterozygote | VUS3- Undef VUS3- Undef |
| Pancreatitis | 4636 | heterozygote | CF-causing- Undef non-CF- Undef |
| Pancreatitis | 5973 | heterozygote | VUS3- Undef VUS3- Undef |
| Pancreatitis | 5155 | heterozygote | VUS3- Undef VUS3- Undef |
| Pancreatitis | 5171 | heterozygote | VUS3- Undef VUS3- Undef |
| Pancreatitis | 5977 | heterozygote | VUS3- Undef |
| Pancreatitis | 776 | heterozygote | varying clinical consequence- Undef CF-causing- Undef |
| Pancreatitis | 5070 | heterozygote | CFTR-RD-causing- Undef non-CF- Undef |
| Pancreatitis | 669 | heterozygote | CF-causing- Undef |
| Pancreatitis | 4692 | heterozygote | varying clinical consequence- Undef CFTR-RD-causing- Undef |
| Pancreatitis | 4708 | heterozygote | CFTR-RD-causing- Undef VUS3- Undef |
| Pancreatitis | 5165 | homozygote | c.2502T>G - p.(Phe834Leu) - Trans c.3718-79T>C - p.(=) - Trans |
| Pancreatitis | 5364 | homozygote | c.3340G>C - p.(Val1114Leu) - Trans |
| Pancreatitis | 5332 | homozygote | |
| Pancreatitis | 5949 | homozygote | c.1210-34_1210-6TG[13]T[5] - Trans c.1521_1523del - p.(Phe508del) - Trans |
| Pancreatitis | 5154 | homozygote | c.350G>A - p.(Arg117His) - Trans c.509G>A - p.(Arg170His) - Trans |
| Pancreatitis | 4743 | homozygote | c.1521_1523del - p.(Phe508del) - Trans c.350G>A - p.(Arg117His) - Trans |
| Pancreatitis | 3253 | homozygote | c.1521_1523del - p.(Phe508del) - Trans c.3205G>A - p.(Gly1069Arg) - Trans |
| Pending (NBS) | 4621 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
| Pending (NBS) | 5183 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef VUS3- Undef |
| Pending (NBS) | 4787 | heterozygote | CF-causing- Undef varying clinical consequence- Undef VUS3- Undef |
| Pending (NBS) | 5816 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef |
| Pending (NBS) | 951 | heterozygote | VUS2- Undef CF-causing- Undef likely CF- Undef |
| Pending (NBS) | 991 | heterozygote | varying clinical consequence- Undef |
| Pending (NBS) | 5342 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
| Pending (NBS) | 5773 | heterozygote | CF-causing- Undef VUS3- Undef VUS3- Undef |
| Pending (NBS) | 5769 | heterozygote | CF-causing- Undef varying clinical consequence- Undef VUS3- Undef |
| Pending (NBS) | 5327 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
| Pending (NBS) | 4631 | heterozygote | varying clinical consequence- Undef CF-causing- Undef |
| Pending (NBS) | 5310 | heterozygote | CF-causing- Undef CF-causing- Undef VUS3- Undef |
| Pending (NBS) | 5313 | heterozygote | CF-causing- Undef VUS3- Undef |
| Pending (NBS) | 775 | heterozygote | CF-causing- Undef |
| Pending (NBS) | 4720 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
| Pending (NBS) | 803 | heterozygote | VUS2- Undef CF-causing- Undef |
| Pending (NBS) | 734 | heterozygote | varying clinical consequence- Undef CF-causing- Undef |
| Pending (NBS) | 6457 | homozygote | c.1521_1523del - p.(Phe508del) - Trans c.617T>G - p.(Leu206Trp) - Trans |
| Pending (NBS) | 5951 | homozygote | c.1521_1523del - p.(Phe508del) - Trans c.870-1113_870-1110del - p.(=) - Trans |
| Pending (NBS) | 4694 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
| Pending (NBS) | 5071 | homozygote | c.-288G>C - p.(=) - Trans c.2657+5G>A - p.(=) - Trans c.3139+89T>C - p.(=) - Trans |
| Pending (NBS) | 5820 | homozygote | c.1624G>T - p.(Gly542*) - Trans c.2989-357C>T - p.(?) - Trans c.3908A>T - p.(Asn1303Ile) - Trans |
| Pending (NBS) | 5247 | homozygote | c.1210-34_1210-6TG[11]T[5] - Trans c.1364C>T - p.(Ala455Val) - Trans c.1521_1523del - p.(Phe508del) - Trans c.53+4A>T - p.(=) - Trans |
| Pending (NBS) | 5808 | homozygote | c.1521_1523del - p.(Phe508del) - Trans c.3874-1_3874delinsAG - p.(?) - Trans |
| Pending (NBS) | 794 | homozygote | c.1521_1523del - p.(Phe508del) - Trans c.617T>G - p.(Leu206Trp) - Trans |
| Pending (NBS) | 799 | homozygote | c.3909C>G - p.(Asn1303Lys) - Trans c.617T>G - p.(Leu206Trp) - Trans |
| Pending (NBS) | 5817 | homozygote | c.1013C>T - p.(Thr338Ile) - Trans c.1521_1523del - p.(Phe508del) - Trans |
| Pending (NBS) | 4654 | homozygote | c.1521_1523del - p.(Phe508del) - Trans c.617T>G - p.(Leu206Trp) - Trans |
| Pending (NBS) | 4644 | homozygote | c.1209G>C - p.(Glu403Asp) - Trans c.2657+5G>A - p.(=) - Trans |
| Pending (NBS) | 4645 | homozygote | c.1000C>T - p.(Arg334Trp) - Trans c.490A>C - p.(Thr164Pro) - Trans |
| Pending (NBS) | 726 | homozygote | c.1521_1523del - p.(Phe508del) - Trans c.1801A>T - p.(Ile601Phe) - Trans |
| Pending (NBS) | 5202 | homozygote | c.1521_1523del - p.(Phe508del) - Trans c.3095A>G - p.(Tyr1032Cys) - Trans c.54-589A>G - p.(=) - Trans |
| Pending (NBS) | 4616 | homozygote | c.1521_1523del - p.(Phe508del) - Trans c.350G>A - p.(Arg117His) - Trans |
| Pending (NBS) | 4643 | homozygote | c.1521_1523del - p.(Phe508del) - Trans c.3458T>A - p.(Val1153Glu) - Trans |
| Pending (NBS) | 5017 | homozygote | c.1521_1523del - p.(Phe508del) - Trans c.3908A>T - p.(Asn1303Ile) - Trans |
| Pending (NBS) | 5190 | homozygote | c.1521_1523del - p.(Phe508del) - Trans c.357C>T - p.(=) - Trans c.54-589A>G - p.(=) - Trans c.617T>G - p.(Leu206Trp) - Trans |
| Bronchiectasis | 5200 | heterozygote | CF-causing- Undef non-CF- Undef VUS3- Undef |
| Bronchiectasis | 5182 | heterozygote | CF-causing- Undef varying clinical consequence- Undef VUS3- Undef |
| Bronchiectasis | 3269 | heterozygote | CF-causing- Undef |
| Bronchiectasis | 966 | heterozygote | VUS3- Undef VUS3- Undef |
| Bronchiectasis | 950 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
| Bronchiectasis | 921 | heterozygote | CF-causing- Undef VUS3- Undef |
| Bronchiectasis | 5530 | heterozygote | CFTR-RD-causing- Undef CFTR-RD-causing- Undef |
| Bronchiectasis | 5331 | heterozygote | VUS3- Undef |
| Bronchiectasis | 5952 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
| Bronchiectasis | 5950 | heterozygote | CF-causing- Undef VUS3- Undef |
| Bronchiectasis | 5624 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
| Bronchiectasis | 5618 | heterozygote | VUS3- Undef |
| Bronchiectasis | 4726 | heterozygote | CFTR-RD-causing- Undef varying clinical consequence- Undef |
| Bronchiectasis | 899 | heterozygote | CF-causing- Undef |
| Bronchiectasis | 5972 | homozygote | c.1210-34_1210-6TG[11]T[5] - Trans c.870-1113_870-1110del - p.(=) - Trans |
| Bronchiectasis | 6435 | homozygote | c.1210-34_1210-6TG[11]T[5] - Trans c.870-1113_870-1110del - p.(=) - Trans |
| Bronchiectasis | 5151 | homozygote | c.3415A>G - p.(Ile1139Val) - Trans c.3824A>T - p.(Asp1275Val) - Trans |
| Bronchiectasis | 4725 | homozygote | c.1521_1523del - p.(Phe508del) - Trans c.1704G>T - p.(Leu568Phe) - Trans |
| Bronchiectasis | 5074 | homozygote | c.1210-34_1210-6TG[11]T[5] - Trans |
| Bronchiectasis | 777 | homozygote | c.1210-34_1210-6TG[11]T[5] - Trans c.1684G>A - p.(Val562Ile) - Trans |
| Bronchiectasis | 5826 | homozygote | c.1521_1523del - p.(Phe508del) - Trans c.3718-2477C>T - p.(=) - Trans |
| Bronchiectasis | 4657 | homozygote | c.1521_1523del - p.(Phe508del) - Trans c.3140-26A>G - p.(=) - Trans |
| Bronchiectasis | 693 | homozygote | c.137C>A - p.(Ala46Asp) - Trans c.350G>A - p.(Arg117His) - Trans c.580-92T>A - p.(=) - Trans |
| Bronchiectasis | 5005 | homozygote | c.1521_1523del - p.(Phe508del) - Trans c.350G>A - p.(Arg117His) - Trans |
| Bronchiectasis | 4623 | homozygote | c.1521_1523del - p.(Phe508del) - Trans c.349C>T - p.(Arg117Cys) - Trans |
| Fetal bowel anomalies | 4738 | heterozygote | CFTR-RD-causing- Undef |
| Fetal bowel anomalies | 5604 | heterozygote | VUS3- Undef |
| Asymptomatic compound heterozygote | 922 | heterozygote | |
| Asymptomatic compound heterozygote | 4628 | heterozygote | VUS3- Undef CFTR-RD-causing- Undef |
| Asymptomatic compound heterozygote | 5164 | heterozygote | CF-causing- Undef |
| Asymptomatic compound heterozygote | 5602 | heterozygote | VUS3- Undef VUS3- Undef |
| Asymptomatic compound heterozygote | 5599 | heterozygote | CF-causing- Undef |
| Asymptomatic compound heterozygote | 5333 | heterozygote | non-CF- Undef CFTR-RD-causing- Undef |
| Asymptomatic compound heterozygote | 4656 | heterozygote | VUS3- Undef VUS3- Undef |
| Asymptomatic compound heterozygote | 4641 | heterozygote | CF-causing- Undef |
| Asymptomatic compound heterozygote | 5167 | heterozygote | varying clinical consequence- Undef |
| Asymptomatic compound heterozygote | 6452 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef |
| Asymptomatic compound heterozygote | 6437 | heterozygote | CFTR-RD-causing- Undef VUS3- Undef |
| Asymptomatic compound heterozygote | 6434 | heterozygote | CFTR-RD-causing- Undef VUS3- Undef |
| Asymptomatic compound heterozygote | 4617 | heterozygote | CF-causing - Cis VUS3 - Trans |
| Asymptomatic compound heterozygote | 5964 | homozygote | c.1327G>T - p.(Asp443Tyr) - Trans c.1521_1523del - p.(Phe508del) - Trans |
| Asymptomatic compound heterozygote | 6440 | homozygote | c.1210-34_1210-6TG[13]T[5] - Trans c.1521_1523del - p.(Phe508del) - Trans |
| Asymptomatic compound heterozygote | 5598 | homozygote | c.1521_1523del - p.(Phe508del) - Trans c.964G>A - p.(Val322Met) - Trans |
| Asymptomatic compound heterozygote | 5601 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
| Asymptomatic compound heterozygote | 5077 | homozygote | c.164+28A>G - p.(=) - Trans |
| Asymptomatic compound heterozygote | 5606 | homozygote | c.1210-34_1210-6TG[11]T[5] - Trans c.1684G>A - p.(Val562Ile) - Trans c.3909C>G - p.(Asn1303Lys) - Trans |
| Asymptomatic compound heterozygote | 5818 | homozygote | c.1210-34_1210-6TG[11]T[5] - Trans |
| Asymptomatic compound heterozygote | 5218 | homozygote | c.1210-34_1210-6TG[11]T[5] - Trans c.2758G>T - p.(Val920Leu) - Trans c.3409A>G - p.(Met1137Val) - Trans |
| Asymptomatic compound heterozygote | 5177 | homozygote | c.2756A>G - p.(Tyr919Cys) - Trans |
| Asymptomatic compound heterozygote | 5140 | homozygote | c.1118A>G - p.(Asp373Gly) - Trans c.1521_1523del - p.(Phe508del) - Trans |
| Asymptomatic compound heterozygote | 5141 | homozygote | c.2756A>G - p.(Tyr919Cys) - Trans |
| Asymptomatic compound heterozygote | 4763 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
| Asymptomatic compound heterozygote | 5525 | homozygote | c.4275T>A - p.(Asp1425Glu) - Trans |
| Pending non-CF | 753 | heterozygote | CF-causing- Undef VUS3- Undef |
| Pending non-CF | 4825 | heterozygote | VUS3- Undef varying clinical consequence- Undef |
| Pending non-CF | 5009 | homozygote | c.*2G>C - p.(=) - Trans c.1521_1523del - p.(Phe508del) - Trans |
| CRS-NP | 910 | heterozygote | CF-causing- Undef |
| CRS-NP | 3284 | heterozygote | varying clinical consequence- Undef CF-causing- Undef |
| CRS-NP | 6442 | heterozygote | CFTR-RD-causing- Undef VUS3- Undef |
| CRS-NP | 5338 | heterozygote | CFTR-RD-causing- Undef non-CF- Undef |
| CRS-NP | 5138 | homozygote | c.3409A>G - p.(Met1137Val) - Trans |
| CRS-NP | 4649 | homozygote | c.1521_1523del - p.(Phe508del) - Trans c.870-1113_870-1110del - p.(=) - Trans |
| Aquagenic palmoplantar keratoderma | 4827 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef |
| Aquagenic palmoplantar keratoderma | 5822 | heterozygote | CFTR-RD-causing- Undef non-CF- Undef |
| Aquagenic palmoplantar keratoderma | 5613 | heterozygote | non-CF- Undef |
| Aquagenic palmoplantar keratoderma | 6335 | homozygote | c.1210-34_1210-6TG[11]T[5] - Trans c.1521_1523del - p.(Phe508del) - Trans |
| Aquagenic palmoplantar keratoderma | 4660 | homozygote | c.2657+5G>A - p.(=) - Trans |
| Aquagenic palmoplantar keratoderma | 5149 | homozygote | c.1210-34_1210-6TG[11]T[5] - Trans c.1521_1523del - p.(Phe508del) - Trans |
| Aquagenic palmoplantar keratoderma | 5772 | homozygote | c.4139C>T - p.(Thr1380Ile) - Trans |
| Pending | 4748 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef |
| Pending | 5771 | heterozygote | CF-causing- Undef CF-causing- Undef |
| Pending | 5008 | homozygote | c.2657+5G>A - p.(=) - Trans c.2988+1G>A - p.(=) - Trans |
| Color code: non disease-causing < likely benign < VUS < likely pathogenic < disease-causing |
| CFTR variants are clustered into five groups (click here for more details about the classification of variants): |
|